ID: 1199420399

View in Genome Browser
Species Human (GRCh38)
Location X:147637477-147637499
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420389_1199420399 17 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420399 X:147637477-147637499 GCTGTACCCTGCAAAGTCACAGG No data
1199420390_1199420399 5 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420399 X:147637477-147637499 GCTGTACCCTGCAAAGTCACAGG No data
1199420395_1199420399 0 Left 1199420395 X:147637454-147637476 CCATGAAAGCAGCCACGAGGGGG No data
Right 1199420399 X:147637477-147637499 GCTGTACCCTGCAAAGTCACAGG No data
1199420393_1199420399 1 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420399 X:147637477-147637499 GCTGTACCCTGCAAAGTCACAGG No data
1199420388_1199420399 24 Left 1199420388 X:147637430-147637452 CCATGAGCCGCAGACAATGCCAG No data
Right 1199420399 X:147637477-147637499 GCTGTACCCTGCAAAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420399 Original CRISPR GCTGTACCCTGCAAAGTCAC AGG Intergenic