ID: 1199420400

View in Genome Browser
Species Human (GRCh38)
Location X:147637478-147637500
Sequence CTGTACCCTGCAAAGTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4989
Summary {0: 58, 1: 1008, 2: 1533, 3: 1330, 4: 1060}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420389_1199420400 18 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420400 X:147637478-147637500 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060
1199420393_1199420400 2 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420400 X:147637478-147637500 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060
1199420390_1199420400 6 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420400 X:147637478-147637500 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060
1199420395_1199420400 1 Left 1199420395 X:147637454-147637476 CCATGAAAGCAGCCACGAGGGGG No data
Right 1199420400 X:147637478-147637500 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060
1199420388_1199420400 25 Left 1199420388 X:147637430-147637452 CCATGAGCCGCAGACAATGCCAG No data
Right 1199420400 X:147637478-147637500 CTGTACCCTGCAAAGTCACAGGG 0: 58
1: 1008
2: 1533
3: 1330
4: 1060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420400 Original CRISPR CTGTACCCTGCAAAGTCACA GGG Intergenic
Too many off-targets to display for this crispr