ID: 1199420401

View in Genome Browser
Species Human (GRCh38)
Location X:147637479-147637501
Sequence TGTACCCTGCAAAGTCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4867
Summary {0: 57, 1: 1030, 2: 1415, 3: 1354, 4: 1011}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420390_1199420401 7 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1199420388_1199420401 26 Left 1199420388 X:147637430-147637452 CCATGAGCCGCAGACAATGCCAG No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1199420395_1199420401 2 Left 1199420395 X:147637454-147637476 CCATGAAAGCAGCCACGAGGGGG No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1199420398_1199420401 -10 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1199420389_1199420401 19 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011
1199420393_1199420401 3 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420401 X:147637479-147637501 TGTACCCTGCAAAGTCACAGGGG 0: 57
1: 1030
2: 1415
3: 1354
4: 1011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420401 Original CRISPR TGTACCCTGCAAAGTCACAG GGG Intergenic
Too many off-targets to display for this crispr