ID: 1199420402

View in Genome Browser
Species Human (GRCh38)
Location X:147637482-147637504
Sequence ACCCTGCAAAGTCACAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3221
Summary {0: 36, 1: 576, 2: 887, 3: 875, 4: 847}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420393_1199420402 6 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG 0: 36
1: 576
2: 887
3: 875
4: 847
1199420388_1199420402 29 Left 1199420388 X:147637430-147637452 CCATGAGCCGCAGACAATGCCAG No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG 0: 36
1: 576
2: 887
3: 875
4: 847
1199420398_1199420402 -7 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG 0: 36
1: 576
2: 887
3: 875
4: 847
1199420395_1199420402 5 Left 1199420395 X:147637454-147637476 CCATGAAAGCAGCCACGAGGGGG No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG 0: 36
1: 576
2: 887
3: 875
4: 847
1199420389_1199420402 22 Left 1199420389 X:147637437-147637459 CCGCAGACAATGCCAGCCCATGA No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG 0: 36
1: 576
2: 887
3: 875
4: 847
1199420390_1199420402 10 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420402 X:147637482-147637504 ACCCTGCAAAGTCACAGGGGTGG 0: 36
1: 576
2: 887
3: 875
4: 847

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420402 Original CRISPR ACCCTGCAAAGTCACAGGGG TGG Intergenic
Too many off-targets to display for this crispr