ID: 1199420403

View in Genome Browser
Species Human (GRCh38)
Location X:147637483-147637505
Sequence TCCACCCCTGTGACTTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4414
Summary {0: 35, 1: 519, 2: 878, 3: 1409, 4: 1573}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420403_1199420412 24 Left 1199420403 X:147637483-147637505 CCCTGCAAAGTCACAGGGGTGGA 0: 35
1: 519
2: 878
3: 1409
4: 1573
Right 1199420412 X:147637530-147637552 CCTCTTGCATCAGTGTGACCTGG 0: 359
1: 772
2: 1292
3: 1411
4: 1259
1199420403_1199420413 25 Left 1199420403 X:147637483-147637505 CCCTGCAAAGTCACAGGGGTGGA 0: 35
1: 519
2: 878
3: 1409
4: 1573
Right 1199420413 X:147637531-147637553 CTCTTGCATCAGTGTGACCTGGG 0: 16
1: 24
2: 46
3: 67
4: 309
1199420403_1199420407 -5 Left 1199420403 X:147637483-147637505 CCCTGCAAAGTCACAGGGGTGGA 0: 35
1: 519
2: 878
3: 1409
4: 1573
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data
1199420403_1199420406 -6 Left 1199420403 X:147637483-147637505 CCCTGCAAAGTCACAGGGGTGGA 0: 35
1: 519
2: 878
3: 1409
4: 1573
Right 1199420406 X:147637500-147637522 GGTGGAACTACCCAAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420403 Original CRISPR TCCACCCCTGTGACTTTGCA GGG (reversed) Intergenic
Too many off-targets to display for this crispr