ID: 1199420404

View in Genome Browser
Species Human (GRCh38)
Location X:147637484-147637506
Sequence TTCCACCCCTGTGACTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420404_1199420412 23 Left 1199420404 X:147637484-147637506 CCTGCAAAGTCACAGGGGTGGAA No data
Right 1199420412 X:147637530-147637552 CCTCTTGCATCAGTGTGACCTGG 0: 359
1: 772
2: 1292
3: 1411
4: 1259
1199420404_1199420407 -6 Left 1199420404 X:147637484-147637506 CCTGCAAAGTCACAGGGGTGGAA No data
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data
1199420404_1199420406 -7 Left 1199420404 X:147637484-147637506 CCTGCAAAGTCACAGGGGTGGAA No data
Right 1199420406 X:147637500-147637522 GGTGGAACTACCCAAGGCCATGG No data
1199420404_1199420413 24 Left 1199420404 X:147637484-147637506 CCTGCAAAGTCACAGGGGTGGAA No data
Right 1199420413 X:147637531-147637553 CTCTTGCATCAGTGTGACCTGGG 0: 16
1: 24
2: 46
3: 67
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420404 Original CRISPR TTCCACCCCTGTGACTTTGC AGG (reversed) Intergenic
No off target data available for this crispr