ID: 1199420405

View in Genome Browser
Species Human (GRCh38)
Location X:147637494-147637516
Sequence CACAGGGGTGGAACTACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420398_1199420405 5 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420405 X:147637494-147637516 CACAGGGGTGGAACTACCCAAGG No data
1199420393_1199420405 18 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420405 X:147637494-147637516 CACAGGGGTGGAACTACCCAAGG No data
1199420390_1199420405 22 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420405 X:147637494-147637516 CACAGGGGTGGAACTACCCAAGG No data
1199420395_1199420405 17 Left 1199420395 X:147637454-147637476 CCATGAAAGCAGCCACGAGGGGG No data
Right 1199420405 X:147637494-147637516 CACAGGGGTGGAACTACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420405 Original CRISPR CACAGGGGTGGAACTACCCA AGG Intergenic
No off target data available for this crispr