ID: 1199420407

View in Genome Browser
Species Human (GRCh38)
Location X:147637501-147637523
Sequence GTGGAACTACCCAAGGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199420393_1199420407 25 Left 1199420393 X:147637453-147637475 CCCATGAAAGCAGCCACGAGGGG No data
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data
1199420404_1199420407 -6 Left 1199420404 X:147637484-147637506 CCTGCAAAGTCACAGGGGTGGAA No data
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data
1199420395_1199420407 24 Left 1199420395 X:147637454-147637476 CCATGAAAGCAGCCACGAGGGGG No data
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data
1199420398_1199420407 12 Left 1199420398 X:147637466-147637488 CCACGAGGGGGGCTGTACCCTGC No data
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data
1199420403_1199420407 -5 Left 1199420403 X:147637483-147637505 CCCTGCAAAGTCACAGGGGTGGA 0: 35
1: 519
2: 878
3: 1409
4: 1573
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data
1199420390_1199420407 29 Left 1199420390 X:147637449-147637471 CCAGCCCATGAAAGCAGCCACGA No data
Right 1199420407 X:147637501-147637523 GTGGAACTACCCAAGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199420407 Original CRISPR GTGGAACTACCCAAGGCCAT GGG Intergenic
No off target data available for this crispr