ID: 1199425154

View in Genome Browser
Species Human (GRCh38)
Location X:147692764-147692786
Sequence CCAATGACGTGGAGACACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199425154_1199425163 27 Left 1199425154 X:147692764-147692786 CCCTTGTGTCTCCACGTCATTGG No data
Right 1199425163 X:147692814-147692836 GCTCAGATTGCAGCAGTCACAGG No data
1199425154_1199425158 -1 Left 1199425154 X:147692764-147692786 CCCTTGTGTCTCCACGTCATTGG No data
Right 1199425158 X:147692786-147692808 GAGCCCCTGCAGATATCTCTTGG No data
1199425154_1199425164 28 Left 1199425154 X:147692764-147692786 CCCTTGTGTCTCCACGTCATTGG No data
Right 1199425164 X:147692815-147692837 CTCAGATTGCAGCAGTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199425154 Original CRISPR CCAATGACGTGGAGACACAA GGG (reversed) Intergenic
No off target data available for this crispr