ID: 1199429233

View in Genome Browser
Species Human (GRCh38)
Location X:147740309-147740331
Sequence CATTCAAGGGTGAGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199429233_1199429239 -4 Left 1199429233 X:147740309-147740331 CCTGCCATCCTCACCCTTGAATG No data
Right 1199429239 X:147740328-147740350 AATGCACATTAGAATCACCTGGG No data
1199429233_1199429238 -5 Left 1199429233 X:147740309-147740331 CCTGCCATCCTCACCCTTGAATG No data
Right 1199429238 X:147740327-147740349 GAATGCACATTAGAATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199429233 Original CRISPR CATTCAAGGGTGAGGATGGC AGG (reversed) Intergenic
No off target data available for this crispr