ID: 1199432216

View in Genome Browser
Species Human (GRCh38)
Location X:147774380-147774402
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199432216_1199432218 27 Left 1199432216 X:147774380-147774402 CCAAGTTCTGGAGTTTATGTCAG No data
Right 1199432218 X:147774430-147774452 ACAGGATCTTGCTGTTGCCCAGG No data
1199432216_1199432217 9 Left 1199432216 X:147774380-147774402 CCAAGTTCTGGAGTTTATGTCAG No data
Right 1199432217 X:147774412-147774434 GATTTGTTTCTTTTTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199432216 Original CRISPR CTGACATAAACTCCAGAACT TGG (reversed) Intergenic