ID: 1199432217 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:147774412-147774434 |
| Sequence | GATTTGTTTCTTTTTGAGAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199432216_1199432217 | 9 | Left | 1199432216 | X:147774380-147774402 | CCAAGTTCTGGAGTTTATGTCAG | No data | ||
| Right | 1199432217 | X:147774412-147774434 | GATTTGTTTCTTTTTGAGACAGG | No data | ||||
| 1199432214_1199432217 | 25 | Left | 1199432214 | X:147774364-147774386 | CCTAGAAATAATGATTCCAAGTT | No data | ||
| Right | 1199432217 | X:147774412-147774434 | GATTTGTTTCTTTTTGAGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199432217 | Original CRISPR | GATTTGTTTCTTTTTGAGAC AGG | Intergenic | ||