ID: 1199432218

View in Genome Browser
Species Human (GRCh38)
Location X:147774430-147774452
Sequence ACAGGATCTTGCTGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199432216_1199432218 27 Left 1199432216 X:147774380-147774402 CCAAGTTCTGGAGTTTATGTCAG No data
Right 1199432218 X:147774430-147774452 ACAGGATCTTGCTGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199432218 Original CRISPR ACAGGATCTTGCTGTTGCCC AGG Intergenic