ID: 1199433203

View in Genome Browser
Species Human (GRCh38)
Location X:147784025-147784047
Sequence GTTTAGGGCTGCCTATGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199433200_1199433203 10 Left 1199433200 X:147783992-147784014 CCAGGATAGGTAGCTAGAGAGAG No data
Right 1199433203 X:147784025-147784047 GTTTAGGGCTGCCTATGACCAGG No data
1199433199_1199433203 21 Left 1199433199 X:147783981-147784003 CCACTAAATATCCAGGATAGGTA No data
Right 1199433203 X:147784025-147784047 GTTTAGGGCTGCCTATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199433203 Original CRISPR GTTTAGGGCTGCCTATGACC AGG Intergenic
No off target data available for this crispr