ID: 1199435099

View in Genome Browser
Species Human (GRCh38)
Location X:147804248-147804270
Sequence GTGAGTGAGGGGTGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199435091_1199435099 10 Left 1199435091 X:147804215-147804237 CCGTGAATTTGTGCCTTGAATCT No data
Right 1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG No data
1199435092_1199435099 -3 Left 1199435092 X:147804228-147804250 CCTTGAATCTCAGTATGTGTGTG No data
Right 1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199435099 Original CRISPR GTGAGTGAGGGGTGGGTGGA AGG Intergenic
No off target data available for this crispr