ID: 1199435596

View in Genome Browser
Species Human (GRCh38)
Location X:147809133-147809155
Sequence TTTGCTTTTTACTGAAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199435596_1199435599 -7 Left 1199435596 X:147809133-147809155 CCCAATTTTCAGTAAAAAGCAAA No data
Right 1199435599 X:147809149-147809171 AAGCAAATGGAGTTTAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199435596 Original CRISPR TTTGCTTTTTACTGAAAATT GGG (reversed) Intergenic
No off target data available for this crispr