ID: 1199440077

View in Genome Browser
Species Human (GRCh38)
Location X:147857822-147857844
Sequence TCCCAATGTTGAGGGAGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199440077_1199440080 1 Left 1199440077 X:147857822-147857844 CCGGGTCTCCCTCAACATTGGGA No data
Right 1199440080 X:147857846-147857868 TTACAAGTCAACATGAGATTTGG 0: 15
1: 1272
2: 5551
3: 13917
4: 14087
1199440077_1199440081 2 Left 1199440077 X:147857822-147857844 CCGGGTCTCCCTCAACATTGGGA No data
Right 1199440081 X:147857847-147857869 TACAAGTCAACATGAGATTTGGG 0: 13
1: 1236
2: 10048
3: 12616
4: 9061

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199440077 Original CRISPR TCCCAATGTTGAGGGAGACC CGG (reversed) Intergenic
No off target data available for this crispr