ID: 1199440088

View in Genome Browser
Species Human (GRCh38)
Location X:147857918-147857940
Sequence ATCTATCAGCTTTTGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199440088_1199440091 8 Left 1199440088 X:147857918-147857940 CCAGCCAGCAAAAGCTGATAGAT No data
Right 1199440091 X:147857949-147857971 TGCAAATATAATAAATATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199440088 Original CRISPR ATCTATCAGCTTTTGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr