ID: 1199445102

View in Genome Browser
Species Human (GRCh38)
Location X:147912037-147912059
Sequence GGCGTGCGGCAGCGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199445088_1199445102 26 Left 1199445088 X:147911988-147912010 CCGACGGCGAGCGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 133
Right 1199445102 X:147912037-147912059 GGCGTGCGGCAGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 22
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199445102 Original CRISPR GGCGTGCGGCAGCGCGGCGG CGG Exonic
900171963 1:1273689-1273711 GGCGAGCCTGAGCGCGGCGGCGG - Exonic
900233332 1:1574179-1574201 GGCGAGGGGCTGCGCGGCGGCGG - Intronic
900269147 1:1778347-1778369 GGCTGGCGGCGGCGCGGCGGCGG - Intronic
900349498 1:2227987-2228009 GGGGCGGGGCGGCGCGGCGGCGG + Intergenic
900414668 1:2529493-2529515 GGCGGGCTGGTGCGCGGCGGCGG + Exonic
900687047 1:3955356-3955378 GGCGTAGGCCAGGGCGGCGGTGG - Intergenic
900786784 1:4654715-4654737 GGCGTGGGGACGCGCGGCGGCGG - Intronic
901059638 1:6466074-6466096 GCCGCGGGGCTGCGCGGCGGTGG - Exonic
902336775 1:15758715-15758737 GGCGCGGGGCGGCGGGGCGGAGG + Intronic
902771278 1:18646875-18646897 GGCGCGGGGCGGCGCGGCGCGGG + Intronic
903044231 1:20553653-20553675 GGCGCGGGGCACCGAGGCGGCGG - Exonic
903324696 1:22563332-22563354 GGCGTGCGCACGTGCGGCGGCGG + Intergenic
905414222 1:37793788-37793810 GGAGAGAGGCGGCGCGGCGGGGG - Exonic
905580658 1:39081245-39081267 GGCGGGCGGAAGCGCAGGGGTGG + Intergenic
905803751 1:40861818-40861840 GGGGCGCGGCCGCGCGGCCGGGG + Exonic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
906116087 1:43358467-43358489 CGCGGGCGGCAGCGGGGCAGGGG - Intergenic
906242424 1:44250241-44250263 GGCGGGCGGCAGGGCTGCCGAGG + Intronic
908123649 1:61008708-61008730 GGGGTGAGGCAGAGGGGCGGGGG + Intronic
910251205 1:85200950-85200972 GGCGCGCGGCGGGGCGGCAGGGG - Exonic
915458071 1:156053706-156053728 GGCGGGCGGCCGGGTGGCGGCGG - Exonic
915552309 1:156642283-156642305 GGCGGGCGGCGGGGCTGCGGAGG - Intronic
920528495 1:206685300-206685322 GGGGTGCGGCAGGGCAGGGGTGG - Exonic
921096329 1:211889786-211889808 GGAGTGCGGGCGCACGGCGGGGG + Intergenic
922241976 1:223761451-223761473 GGGGTGGGGCAGGGCTGCGGTGG - Intronic
922739377 1:228006897-228006919 GGGGCGGGGCAGCGCCGCGGGGG - Intergenic
1063201047 10:3785533-3785555 CGCGGGCGGCCGCGCGCCGGAGG + Intergenic
1063450201 10:6145566-6145588 GGAGAGGGGCAGCGCGGCGCGGG + Intronic
1063995087 10:11611515-11611537 GGCGCGGCGCGGCGCGGCGGCGG + Intronic
1066406994 10:35127412-35127434 GGCGTGGGGCGGCGAGCCGGCGG - Intronic
1066464199 10:35639445-35639467 GGCGGGGGGCCGGGCGGCGGCGG - Exonic
1067831692 10:49614366-49614388 GGCGTGTCGCAGCGCGGGGGTGG - Exonic
1069186452 10:65429392-65429414 GGAGTGCGGGAGCACAGCGGGGG - Intergenic
1072107891 10:92291305-92291327 GGCCTGCGGGAGTCCGGCGGAGG - Exonic
1072189073 10:93066093-93066115 CGCGTGCGGCTGCGCGCCCGGGG + Exonic
1073099656 10:100999931-100999953 AGCATGGAGCAGCGCGGCGGAGG + Exonic
1073363522 10:102918657-102918679 TGCGGGCGGCTGCGCAGCGGTGG + Exonic
1075032167 10:119030612-119030634 GGCGGGCGGGCGGGCGGCGGCGG - Exonic
1075748311 10:124743493-124743515 GGGGTGCGGGAGCGAGGCGGCGG - Intronic
1076373907 10:129971352-129971374 GGGGTGCGTCGGCGCGGGGGCGG + Intergenic
1076792878 10:132786100-132786122 GGCGGGCGGGCGGGCGGCGGCGG + Intergenic
1077063423 11:627308-627330 GAGGGGCGCCAGCGCGGCGGAGG - Intergenic
1077214689 11:1390454-1390476 GGCCTGCGGCTTCGCGGCCGGGG - Intronic
1077459357 11:2700837-2700859 GGCGCGCGCCAGCGGCGCGGAGG - Intronic
1077544941 11:3165175-3165197 GGGGGGCGGCAGGGCGGCGGGGG - Intronic
1078594421 11:12674490-12674512 GGCGGGCGGCGGGGCCGCGGCGG - Intergenic
1080540097 11:33257307-33257329 GGCGGGCGGTGGCGCTGCGGAGG + Intronic
1081861002 11:46333279-46333301 GCCGAGGGGCAGGGCGGCGGAGG + Intronic
1084086354 11:66857062-66857084 GGCGAGCGGGTGCGCGCCGGCGG - Intronic
1086210051 11:84308534-84308556 GGAGTGCGGGCGCACGGCGGGGG - Intronic
1088250659 11:107858623-107858645 GGCGTGCTGCAGCTCCGCTGGGG - Intronic
1088764384 11:112962006-112962028 GGCGGGCGGCGGGGCGGGGGAGG + Intronic
1089346989 11:117797001-117797023 CGCGGGCGGCTGGGCGGCGGAGG - Intronic
1089622358 11:119729130-119729152 GGCACCCGGCAGAGCGGCGGCGG - Intergenic
1089943263 11:122441228-122441250 GAGGTGGGGCAGCGCGGGGGCGG + Intergenic
1091295479 11:134471307-134471329 GGTGTGGGGCAGCGCGGGGAGGG - Intergenic
1095206107 12:39442677-39442699 GGCTGGCGGCTGCGCGGCGCCGG - Intronic
1097190419 12:57216870-57216892 GGCGGGCGGCGGGGCGGCTGCGG - Exonic
1100963075 12:99984750-99984772 GGCGGGGAGGAGCGCGGCGGCGG + Intergenic
1101705976 12:107221619-107221641 GGCGGGCGGCGGGGCGGCGGGGG + Intergenic
1103749796 12:123150898-123150920 GGCGAGCGGCAGAGCCCCGGCGG + Intergenic
1105578655 13:21674508-21674530 TGTGCGCGGGAGCGCGGCGGGGG + Intronic
1108409656 13:50133497-50133519 GGCGCTCGGCAGCGGGGCAGAGG + Intronic
1110436308 13:75481536-75481558 GGCGGGCGGCTGCGGGGCGCCGG - Exonic
1111672457 13:91348050-91348072 GGCCCGGGGCAGCGTGGCGGCGG + Intergenic
1113201067 13:107867600-107867622 GGCGGGCGGCGGCGGGGCCGCGG + Intergenic
1113643626 13:111976356-111976378 GGCGGGCGGGGGGGCGGCGGCGG + Intergenic
1114637419 14:24195658-24195680 GGCGATCGGCAGCGCGGCCCAGG + Intronic
1115851749 14:37595019-37595041 GACGGGCGGCCGCGCGGCGCGGG + Exonic
1116822501 14:49639170-49639192 GGAGTGCAGCAGCGCGATGGCGG + Intergenic
1117157035 14:52951263-52951285 GGCGTGGGGCGGGGCGGCGCGGG + Intronic
1117297630 14:54393816-54393838 GGAGTGCGGGTGCACGGCGGCGG + Intergenic
1118849319 14:69572372-69572394 AGCGCGAGGCGGCGCGGCGGCGG - Exonic
1119325786 14:73759070-73759092 GGCGTGCGGGGGCGCGCGGGAGG + Intronic
1121732161 14:96194449-96194471 GGCCTGCGGCAGCACGGGGCAGG + Intergenic
1121865134 14:97355950-97355972 GGCGTGAGCCAGGGAGGCGGAGG - Intergenic
1122582171 14:102777702-102777724 GGCGCCCGGCCGCGCGCCGGAGG - Intronic
1122582231 14:102777864-102777886 GGCGGGAGGCAGCCCGGCTGGGG - Intronic
1122931107 14:104933439-104933461 GGAGCGCGGCAGCCCGGCGCGGG - Exonic
1122959396 14:105087576-105087598 GGCGGGCAGCCTCGCGGCGGCGG + Intergenic
1123423254 15:20148292-20148314 GGACAGCGGCGGCGCGGCGGAGG + Intergenic
1124121326 15:26891762-26891784 GGTGTCCGGAAGCGCGGTGGTGG - Intronic
1124249360 15:28096970-28096992 GGCTTGCGGCAGCGGCGCCGCGG - Intronic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124500738 15:30225071-30225093 GGCCTGCTGCAGCGTGGCGATGG - Intergenic
1124742831 15:32313596-32313618 GGCCTGCTGCAGCGTGGCGATGG + Intergenic
1125516432 15:40323733-40323755 AGCGCGCGGCGGCGTGGCGGCGG + Intergenic
1127207180 15:56733291-56733313 GGAGACCGGCTGCGCGGCGGCGG - Intronic
1127606511 15:60592478-60592500 GGGCGGCGGCGGCGCGGCGGCGG - Intronic
1127994786 15:64147182-64147204 GGCGGGCGGCAGCGGAGGGGTGG - Intergenic
1130564445 15:84981753-84981775 GTCGTGCCGCAGCTCGGCGAGGG + Intronic
1131475385 15:92734218-92734240 GGCGCGCGGCGGGGCGGAGGCGG - Intronic
1131701562 15:94942662-94942684 GGAGGGCGGCAGGGCGGGGGCGG - Intergenic
1131827374 15:96332044-96332066 TGCGGGCGGCGGCGGGGCGGCGG - Exonic
1132512835 16:352711-352733 GGCGTCCGGAAGTGCGGGGGCGG + Intergenic
1132527851 16:426274-426296 CGCGGGCCGGAGCGCGGCGGCGG - Exonic
1132683323 16:1152681-1152703 CGCGCGCGGCAGCGCGAAGGGGG + Intergenic
1132719650 16:1309484-1309506 GGGGCGCGGGCGCGCGGCGGCGG + Intronic
1132719654 16:1309492-1309514 GGCGCGCGGCGGCGGGGCGCGGG + Intronic
1132728707 16:1350121-1350143 GGCCTGCGGCAGCCCGGAGGAGG - Exonic
1132831326 16:1929810-1929832 TGCGTGCGCAGGCGCGGCGGGGG - Intergenic
1132978210 16:2720998-2721020 GGCGCGCGCCAGCGCGGCCCAGG + Intergenic
1137300496 16:47143875-47143897 GGAGTGCGGACGCGCGGCGCGGG + Exonic
1138507697 16:57486386-57486408 CGGGGGCGGCAGGGCGGCGGCGG + Exonic
1138514583 16:57529038-57529060 GGCGTGCCGCTGGGCGGCGTGGG + Exonic
1139364966 16:66427438-66427460 GGCGTGGGGCTGGGCGGCGCGGG + Intronic
1139446401 16:67001085-67001107 GGGGTGGGGCCGCGAGGCGGGGG + Intronic
1139471005 16:67178177-67178199 GGTGTGCGCCAGCGCGGGGGAGG - Exonic
1141430562 16:83968588-83968610 GGCGGGCCGCAGCTGGGCGGGGG + Intergenic
1141456274 16:84144767-84144789 GGGGTGCAGCGCCGCGGCGGGGG + Intronic
1141642409 16:85348948-85348970 GGGGAGCGGCAGGGCGGTGGGGG - Intergenic
1141831095 16:86510356-86510378 GGCGGGCGGGAGCGCGGGGGCGG + Intergenic
1142683301 17:1562504-1562526 GCCGTGCGGAAGCGGGGAGGAGG - Intronic
1143617784 17:8064092-8064114 GGGGCGAGGCAGCGTGGCGGGGG - Intergenic
1146398539 17:32486910-32486932 CGGGAGCGGGAGCGCGGCGGCGG + Exonic
1147210421 17:38869919-38869941 GACGTGGGGCTGCGCGGGGGCGG - Exonic
1147440331 17:40443658-40443680 GGCGCGCGGGCGAGCGGCGGAGG - Exonic
1149849395 17:60026306-60026328 GGTCTGCGGCCCCGCGGCGGGGG - Intergenic
1149860773 17:60120218-60120240 GGTCTGCGGCCCCGCGGCGGGGG + Intergenic
1150134728 17:62689540-62689562 GGCGGGGGGCAGCGCTGCTGGGG - Exonic
1150286149 17:63955356-63955378 GGCGTGCGGCAGGGCAGTGCTGG - Intronic
1151580154 17:74972878-74972900 GGCGTGCGGCGGCGCTGGGTTGG - Intronic
1152696606 17:81800791-81800813 GGCGGGCTGCAGCGGGGCTGGGG - Intergenic
1152924218 17:83080055-83080077 AGCGTGCGGGGGCGCGGCCGGGG + Intronic
1154202330 18:12308176-12308198 GGCGAGCGGCGGGGCGGGGGCGG + Exonic
1154348575 18:13564684-13564706 GGGGGGCGGCAGCGCAGAGGCGG - Intronic
1154980678 18:21500095-21500117 GGCGTGGGGCAGCAGGGAGGAGG - Exonic
1156275709 18:35581453-35581475 CCCGTGCGGCTGCGCGGGGGAGG - Intronic
1157614004 18:48976169-48976191 GGCCCGCGGGAGCGGGGCGGCGG + Intergenic
1159947787 18:74457032-74457054 GGCGCGGGGCAGAGCGGCGGCGG + Intronic
1160025338 18:75211496-75211518 GCCCAGCAGCAGCGCGGCGGCGG + Intronic
1160218473 18:76955302-76955324 GGCGTGCGGGAGGGCTGGGGTGG + Intronic
1161007472 19:1943816-1943838 GGCCTGGGGCAGCTCGGTGGGGG - Intronic
1161236622 19:3201468-3201490 GGGGTGCGGGAGCCGGGCGGGGG + Intronic
1161265155 19:3360340-3360362 CGCGCGCGGCAGCGGGGCCGGGG - Intronic
1161453854 19:4360758-4360780 GGCCCTCGGCAGCGCGGCTGTGG + Exonic
1161461504 19:4400359-4400381 GGCGGGCGGCAGCATGTCGGTGG - Exonic
1162929894 19:13952589-13952611 AGCGGGCAGCAGGGCGGCGGCGG + Exonic
1163592827 19:18203975-18203997 GATGTGGGGCTGCGCGGCGGCGG + Exonic
1163598245 19:18232909-18232931 GGCCTCCTGCAGCGCGGGGGAGG - Intronic
1163666632 19:18606682-18606704 GGCGGGCTGCGGCTCGGCGGCGG + Exonic
1166367247 19:42284016-42284038 GGCGGGGGGAGGCGCGGCGGGGG + Intronic
1166721795 19:45001413-45001435 GGCGGGCGGGGGCGGGGCGGCGG - Exonic
1167617453 19:50543221-50543243 TGCAGGTGGCAGCGCGGCGGGGG + Intronic
1167743932 19:51340181-51340203 GGCGGGCGGCCGCGAGGCGGCGG + Exonic
1168076336 19:53982573-53982595 GGCGTTCGGCGGCGCGGCCGGGG + Exonic
1168344314 19:55642939-55642961 GGTGTGCGGCGGCCCGGCGCGGG - Exonic
1168718985 19:58544636-58544658 GGCGCTCGGCCTCGCGGCGGCGG + Exonic
928303525 2:30147324-30147346 GTCGCCCGGCTGCGCGGCGGGGG - Intronic
929857859 2:45651291-45651313 GGCGGTGCGCAGCGCGGCGGCGG - Intergenic
930872756 2:56184633-56184655 GGCGGCCGGAGGCGCGGCGGCGG + Exonic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
934566979 2:95346606-95346628 GGGGCGCGGGGGCGCGGCGGCGG - Intronic
935591748 2:104851615-104851637 GGGGTGGGGCAGCGTGGAGGGGG + Intergenic
937418657 2:121737221-121737243 GGCGTGCCGAGGCGCGGCAGCGG + Intronic
938727387 2:134120476-134120498 GGCGTCCTGCAGAGCGGCCGGGG - Intronic
938866102 2:135422487-135422509 GGCGGGGGGCAGGGGGGCGGCGG + Intronic
939003958 2:136765284-136765306 GTCGTGCGGGTGCGCGGCAGAGG + Intergenic
942453308 2:176121977-176121999 GGCGAGCCGGGGCGCGGCGGTGG - Intergenic
945245234 2:207711661-207711683 AGGCGGCGGCAGCGCGGCGGTGG + Intronic
946340126 2:219061087-219061109 GGCGGGCGGACGCGCGGCGGAGG - Intergenic
947745055 2:232503177-232503199 CGGGGGCGGGAGCGCGGCGGGGG - Intergenic
947800948 2:232928237-232928259 GCCGGGCGGCGGCGGGGCGGGGG + Intronic
1169516419 20:6321411-6321433 GCCGGGCGGCAGCGAGGCTGGGG - Intergenic
1175847421 20:62065933-62065955 GGCGCGCGGCCGGGGGGCGGGGG + Intergenic
1176081055 20:63273148-63273170 GGCGGGGGGCGGCACGGCGGAGG - Intronic
1176548482 21:8211936-8211958 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1176556376 21:8256144-8256166 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1176567413 21:8394971-8394993 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1176575315 21:8439186-8439208 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1178493832 21:33070875-33070897 GGCGGGGCGCAGCGCGTCGGGGG - Exonic
1178948488 21:36966892-36966914 GGCGAGGGGCAGCGCTGGGGCGG + Intronic
1180216202 21:46324915-46324937 GGCGGCCGGGAGCGCCGCGGGGG - Intronic
1180750261 22:18119604-18119626 AGCGTGGGGCAGCCCGACGGGGG - Intronic
1181025127 22:20123472-20123494 GGGGTGCGGTATCGCGGTGGGGG + Intronic
1182445469 22:30387166-30387188 GGCGGACGGCAGCGAGCCGGCGG - Exonic
1183071619 22:35400308-35400330 GGAGTCCGGGAGCGCGGCCGGGG + Intronic
1183486188 22:38088895-38088917 GGCGAGCGCCCGGGCGGCGGCGG - Exonic
1184276478 22:43411946-43411968 GGCGCGCGGGCGGGCGGCGGAGG + Intronic
1184412216 22:44331843-44331865 GGCGGGCGGCCGGGCGGCGCGGG - Intergenic
1184412237 22:44331897-44331919 GGCGAGCATGAGCGCGGCGGCGG - Intergenic
1184492818 22:44820149-44820171 GGCGTGCGGCAGAGTTGCTGGGG - Intronic
1184659467 22:45959245-45959267 GGTGGGCAGCAGCGCGGCCGTGG + Intronic
1203253366 22_KI270733v1_random:128241-128263 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1203261420 22_KI270733v1_random:173319-173341 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
950153844 3:10708046-10708068 GGCGGGCGGCGGCGGGGCCGCGG - Intergenic
950487781 3:13283018-13283040 AGCGGGCGGCGGGGCGGCGGCGG + Intergenic
950759309 3:15206414-15206436 GGACTGCGGCGGCCCGGCGGCGG - Exonic
950805772 3:15601905-15601927 GGCGTGGTGCGGCGCGGAGGGGG + Intronic
951485210 3:23202978-23203000 GGCGCGCGGCCGCGAGGGGGCGG - Intergenic
951558941 3:23946356-23946378 GGCGTGCTGCAGGCCGGAGGAGG + Intronic
953801081 3:46023117-46023139 GCCGTGCGGGGTCGCGGCGGCGG + Intronic
958554401 3:95655768-95655790 CGCGGGCGGCAGCTCTGCGGGGG + Intergenic
961603041 3:128075683-128075705 GGGGAGGGGCAGCGCGGCGGGGG + Intronic
962301883 3:134250631-134250653 TGCGTGGGGCGGCGCGGCTGGGG - Exonic
962332037 3:134486463-134486485 GGCGTGGCGCAGCCCGGCGTGGG + Intronic
962575354 3:136751591-136751613 GGGGTGGGGCAGCGGGGTGGCGG - Intronic
963732640 3:148987671-148987693 GGCGGGCGGCCGGGTGGCGGCGG - Intergenic
966182224 3:177197637-177197659 GGCGGGCGGGCGCGCGGGGGAGG + Intergenic
967685277 3:192409904-192409926 GGGAGGCGGCGGCGCGGCGGCGG - Intronic
968657565 4:1785282-1785304 GGCGGGCGGAAGGGCGGCCGTGG + Intergenic
968702624 4:2064128-2064150 GGCGGGCGGGCGAGCGGCGGCGG - Exonic
968732476 4:2276132-2276154 GGGCTGCGGCAGAGCGGGGGAGG + Intronic
969214551 4:5711466-5711488 GGCGCCCAGCAGCACGGCGGGGG - Exonic
969551048 4:7867385-7867407 AGCCTGAGGCAGCGCGGGGGCGG + Intronic
969619040 4:8269802-8269824 GGCGGGCGTCAGGGCGGCAGGGG - Exonic
971018999 4:22515850-22515872 GGCGGGCAGGAGCGCGGCGCGGG + Exonic
971639890 4:29117731-29117753 GGAGTGCGGGAGCACGGCGCTGG + Intergenic
975420522 4:74158374-74158396 CGTGGGCGGCCGCGCGGCGGCGG + Intronic
976199029 4:82561586-82561608 GGCTGGCGGCACTGCGGCGGCGG + Intronic
981782375 4:148443709-148443731 GGCGACCCGCAGCCCGGCGGCGG + Intronic
983088268 4:163473593-163473615 GTCGTGCTGCAGTGCAGCGGAGG - Exonic
984830546 4:183968744-183968766 GGGTTGCGGCAGGGGGGCGGGGG + Intronic
985688625 5:1294978-1295000 AGCGCGCGGCATCGCGGGGGTGG + Exonic
987896360 5:23951674-23951696 GGAGTGCGGGCGCGCGGCGCGGG + Exonic
988825283 5:34929585-34929607 GGCAAGCGGGAGCGCGGCGGGGG - Exonic
993803471 5:92374876-92374898 GGGGTGCGGGCGCACGGCGGGGG - Intergenic
996435766 5:123430932-123430954 GGAGTGCGGGCGCACGGCGGGGG + Intergenic
997378397 5:133415726-133415748 GTGGTGCGGCAGCGTGGCAGGGG + Intronic
997732618 5:136192261-136192283 GTCGTGGGGCAGCGCGGCGAAGG + Intergenic
997899637 5:137753459-137753481 GGCGGCCGGGGGCGCGGCGGTGG - Exonic
1001906706 5:175478922-175478944 GGCGCGCGGGGACGCGGCGGAGG - Intronic
1002710423 5:181191802-181191824 GGACTGCGGCTGCGCGGCGCCGG - Intergenic
1003873166 6:10417264-10417286 GGCGCGGGGCAGCGGGGAGGTGG - Intronic
1004193872 6:13487271-13487293 GGGCTGCGGCGGCGCGGCCGCGG - Exonic
1004615041 6:17281430-17281452 CGAGGGCGGCGGCGCGGCGGGGG - Exonic
1004627973 6:17394089-17394111 GGCGGGCGGCGGCGCTGGGGTGG - Intronic
1005825203 6:29628084-29628106 GGCGCGCGGCAGCGGGGGGTGGG + Intronic
1005968274 6:30742536-30742558 CGCGGGCGGCAGCCCGGCTGGGG + Exonic
1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG + Exonic
1010703308 6:79077786-79077808 GGCGTGGGGGAGGGAGGCGGCGG - Intronic
1011194040 6:84764184-84764206 GGCGGGCGGGCGCGGGGCGGGGG - Exonic
1011277400 6:85643646-85643668 GGCGGGCGGGAGCTCGGTGGGGG - Intronic
1011416247 6:87122755-87122777 GGGGTCTCGCAGCGCGGCGGCGG + Intergenic
1011517136 6:88166598-88166620 GGCCTCCGGGAGCGCGGCGGCGG - Intergenic
1013273188 6:108560829-108560851 GACCTGCGGCTGGGCGGCGGGGG + Intronic
1016714096 6:147204075-147204097 GGCGAGCAGCGGCGCGGCCGCGG + Intergenic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1018876653 6:167827296-167827318 GGCGGGCGGCGGCGGGGGGGAGG - Intronic
1019573628 7:1725471-1725493 GGTGTGAGGCAGAGCGGGGGTGG + Intronic
1019989508 7:4682101-4682123 GGCGCGCGCCAGCGCGGGGCTGG - Intergenic
1022722938 7:32957313-32957335 TGCGTGCCGCAGCGGGGAGGGGG - Intergenic
1023951268 7:44847988-44848010 GGCGCGCGGCCGAGCGGAGGCGG - Exonic
1024579827 7:50792974-50792996 GGGCTGCGGGCGCGCGGCGGAGG - Intronic
1025231010 7:57203344-57203366 GGCGCACGGAAGCCCGGCGGAGG - Intergenic
1025730001 7:64100480-64100502 GGCGCCCGGAAGCCCGGCGGTGG + Intronic
1026732777 7:72925644-72925666 GGCGGTGGGGAGCGCGGCGGTGG - Intronic
1026732782 7:72925659-72925681 GGCGGGGGGGAGCGCGGCGGTGG - Intronic
1030138705 7:106284575-106284597 GGCCTGGGGGCGCGCGGCGGCGG - Intronic
1030138772 7:106284754-106284776 AGCGCGCGGCAGGGGGGCGGGGG - Intronic
1030176445 7:106660261-106660283 GCCTGGCGGCAGCGCGGCGCAGG - Exonic
1031088433 7:117324697-117324719 GGCGGCAGGCAGCGGGGCGGGGG + Intergenic
1031965842 7:128027805-128027827 GGGGTGCGGCAGCAGGGGGGTGG - Exonic
1031966682 7:128032232-128032254 GGCGCGGGGCTGCGCGGCGCCGG - Intronic
1033477156 7:141702082-141702104 GGCCTGCGGCAGGGAGACGGCGG + Exonic
1034441142 7:151086644-151086666 GGCGAGCGGGAGCGCGGGGCTGG - Intronic
1034441158 7:151086692-151086714 GGCCCGGGGCGGCGCGGCGGAGG - Intronic
1034450838 7:151136414-151136436 GGCATGCGGCAGCGGGACGCGGG - Intronic
1034560584 7:151877158-151877180 GGCGAGAGGGAGGGCGGCGGGGG + Intergenic
1034978941 7:155463588-155463610 GGCCTGCGGCAGGACTGCGGTGG - Exonic
1036912075 8:12765935-12765957 GGAGTGCGCCAGCCCTGCGGAGG + Intergenic
1037807576 8:22067024-22067046 TGTGTGCGGGAGCGGGGCGGGGG - Intronic
1040312781 8:46245347-46245369 GGCGTGCCGCAGGGTGGCGTGGG + Intergenic
1042591599 8:70403041-70403063 GGCGAGCTGCAGCGCGGGGCGGG - Intronic
1049557594 8:143290927-143290949 GGCGTCCTGCAGGGAGGCGGGGG + Intronic
1049740797 8:144239976-144239998 GGTGGGGGGCAGCGGGGCGGCGG + Intronic
1049801017 8:144517576-144517598 AGCGCGCGGCGGGGCGGCGGGGG - Intronic
1050094248 9:2047313-2047335 CGCGGGCGGCTGCGCGGCTGCGG - Exonic
1051170660 9:14315626-14315648 GGGGCGGGGCAGCGCCGCGGTGG - Intronic
1053690454 9:40584295-40584317 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690474 9:40584357-40584379 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690482 9:40584383-40584405 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690499 9:40584438-40584460 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1053690507 9:40584464-40584486 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054274315 9:63053058-63053080 GGTCGGCGGCGGCGCGGCGGAGG + Intergenic
1054274323 9:63053084-63053106 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054274344 9:63053154-63053176 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054301716 9:63385282-63385304 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301724 9:63385308-63385330 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301732 9:63385334-63385356 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301740 9:63385360-63385382 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301748 9:63385386-63385408 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054301756 9:63385412-63385434 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400479 9:64711774-64711796 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400499 9:64711836-64711858 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400507 9:64711862-64711884 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054400515 9:64711888-64711910 GGCGGTCGGCGGCGGGGCGGCGG - Intergenic
1054400524 9:64711914-64711936 GGCGGTCGGCGGCGGGGCGGCGG - Intergenic
1054434065 9:65196018-65196040 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434071 9:65196036-65196058 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434077 9:65196054-65196076 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434097 9:65196116-65196138 GGGCGGCGGCGGCGCGGCGGAGG - Intergenic
1054434098 9:65196119-65196141 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434106 9:65196145-65196167 GGGCGGCGGCGGCGCGGCGGAGG - Intergenic
1054434107 9:65196148-65196170 GGCGGGCGGCGGCGGCGCGGCGG - Intergenic
1054434115 9:65196174-65196196 GGTCGGCGGCGGCGCGGCGGAGG - Intergenic
1054434130 9:65196229-65196251 GGCGGTCGGCGGCGGGGCGGCGG - Intergenic
1054496266 9:65825477-65825499 GGCGGTCGGCGGCGGGGCGGCGG + Intergenic
1054496285 9:65825540-65825562 GGTCGGCGGCGGCGCGGCGGAGG + Intergenic
1054496293 9:65825566-65825588 GGCGGGCGGCGGCGGCGCGGCGG + Intergenic
1054496294 9:65825569-65825591 GGGCGGCGGCGGCGCGGCGGAGG + Intergenic
1055632203 9:78236134-78236156 GGCGGGAGGCAGCGCGGGAGTGG + Intronic
1056102439 9:83312748-83312770 GGCGGGGCGCAGGGCGGCGGAGG - Intronic
1057259417 9:93575913-93575935 GGAGGGAGGCAGCGCGGCCGAGG + Intergenic
1058053348 9:100427413-100427435 GGCGGGCCGCAGCCGGGCGGGGG + Intronic
1060215539 9:121736427-121736449 GGCGTGCCGAAGCGCAGCGGCGG + Intronic
1060700671 9:125747123-125747145 GGCGCGCGGCGGCGAGGAGGCGG + Intergenic
1060949530 9:127592721-127592743 GGGGTGTGGCAGGGCGGTGGGGG + Intergenic
1061108771 9:128552468-128552490 GGGGTGGGGGAGCGCGCCGGCGG - Intergenic
1061328071 9:129876011-129876033 GGCCTGCGACAGCGCTGAGGGGG + Intronic
1062022575 9:134326388-134326410 GGGGCGCGGGCGCGCGGCGGCGG + Intronic
1062272121 9:135714433-135714455 GGCGGGCGGCCGGGCGGGGGCGG - Intronic
1062272220 9:135714755-135714777 GGCGTGCGGCGGCGCCGGGACGG - Intronic
1062472458 9:136712494-136712516 GGCCGACGGCGGCGCGGCGGGGG - Intergenic
1062562062 9:137146149-137146171 GGCGCTCGGCAGCGCGGGGCAGG - Intronic
1062574637 9:137200494-137200516 GCCGAGCGGCGGCGCGGCGGGGG - Exonic
1062659093 9:137619065-137619087 GGCGGGGGGCGGCGCGGGGGCGG + Intronic
1203469766 Un_GL000220v1:111388-111410 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1203477587 Un_GL000220v1:155360-155382 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1185471409 X:386290-386312 GGCGTGTGGCTGCGCGATGGAGG - Intronic
1185779074 X:2829637-2829659 GGCGTCCGGGAGCGCAGGGGTGG + Intronic
1185837771 X:3361060-3361082 GGCGGACGGCAGCGGGCCGGCGG - Intergenic
1187848507 X:23566370-23566392 GCAGTGCGGCAGCGAGGCTGGGG - Intergenic
1187915429 X:24149409-24149431 GGCGGGCGGGAGCGCGGAGGAGG + Intronic
1190758605 X:53422151-53422173 GGCGGGGAGCCGCGCGGCGGAGG + Intronic
1199445102 X:147912037-147912059 GGCGTGCGGCAGCGCGGCGGCGG + Exonic
1200128957 X:153830762-153830784 GGGGGGCAGCGGCGCGGCGGCGG + Intergenic
1200310282 X:155071173-155071195 GGCGTCAGGCCGGGCGGCGGGGG - Exonic