ID: 1199446268

View in Genome Browser
Species Human (GRCh38)
Location X:147926077-147926099
Sequence ATGTATAAACTAAAGCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199446268_1199446270 2 Left 1199446268 X:147926077-147926099 CCTACAAGCTTTAGTTTATACAT 0: 1
1: 0
2: 1
3: 17
4: 217
Right 1199446270 X:147926102-147926124 TGGTAAAATCTCTTTTTCACAGG 0: 1
1: 1
2: 1
3: 25
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199446268 Original CRISPR ATGTATAAACTAAAGCTTGT AGG (reversed) Intronic
901118340 1:6867671-6867693 ATGTATACACTACAGTTAGTGGG - Intronic
902403168 1:16168958-16168980 ATGAGAAAACTAAAGCTGGTAGG + Intergenic
903716711 1:25373133-25373155 ATGTAAAGAAGAAAGCTTGTTGG + Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910978765 1:92937468-92937490 CTGTAAAAAATAAAGCATGTGGG - Intronic
916626343 1:166560409-166560431 ATTTATAAACCAAAAATTGTAGG + Intergenic
917377972 1:174370936-174370958 ATATATAAAATAATGTTTGTTGG + Intronic
917500622 1:175581851-175581873 ATGAATAAGCACAAGCTTGTCGG - Intronic
917633676 1:176915316-176915338 ATGAAGAAACTAAGGCTTGGAGG + Intronic
918454207 1:184690343-184690365 CTGTAGAAACCCAAGCTTGTGGG - Exonic
920285991 1:204880183-204880205 AAGTCTAACCTAAAGCCTGTAGG - Intronic
920718112 1:208360376-208360398 ATGTATGAACTAGAGGTTGAGGG - Intergenic
920948034 1:210547744-210547766 ATGTATAAATTAAAGCTATGCGG - Intronic
921956722 1:220992707-220992729 TTGGACAAACTAAAGCTGGTTGG + Intergenic
1063285785 10:4686253-4686275 ATGTTTAAATTAACGCATGTAGG - Intergenic
1065184412 10:23157930-23157952 ATTTCTAAACTACAGCTGGTCGG - Intergenic
1066488831 10:35874605-35874627 ATGTATAAGGGAAAGCTTGCAGG + Intergenic
1066586223 10:36939557-36939579 ATGAATAAACTATAGTTTGGGGG + Intergenic
1066587367 10:36950563-36950585 ATTTTTTAACTAAAGCTTATCGG + Intergenic
1066611453 10:37252428-37252450 ATGTATAAAATAAAACTTAGTGG + Intronic
1068156234 10:53202755-53202777 ATGGATAAATCAAAGCTTCTTGG + Intergenic
1070268863 10:74932330-74932352 ATGTAGAAACTAAAACTTAGAGG + Intronic
1070792516 10:79197739-79197761 ATGAAGAAACTAAGGCTTGGAGG - Intronic
1071775431 10:88781722-88781744 ATCTATATACTAAAAATTGTTGG - Intergenic
1075213233 10:120509553-120509575 ATCTGTAAACTAAAGCTTTTGGG + Intronic
1078331911 11:10429266-10429288 ATGAATAATCTAAGGCTTGAAGG + Intronic
1080063201 11:27979967-27979989 TTTTATTAACTGAAGCTTGTTGG + Intergenic
1082195008 11:49293268-49293290 TTGTTTAAAATACAGCTTGTGGG - Intergenic
1084931259 11:72557871-72557893 ATGTCTATATTAAAGCTTCTGGG + Intergenic
1085294329 11:75422442-75422464 TTGTATAAATAAAATCTTGTTGG - Exonic
1085901971 11:80710868-80710890 ATGAATAAACTATAGTTTGGGGG - Intergenic
1087779716 11:102289435-102289457 AGGTATAAACAAAATTTTGTGGG + Intergenic
1088533259 11:110833509-110833531 AAGTATAAAAGAAAGCTTGGGGG - Intergenic
1091450129 12:567456-567478 AAGTATAAAATAAAGCTTCATGG + Intronic
1091514048 12:1160249-1160271 ATGTATCACCTAAATCTTTTGGG - Intronic
1092991874 12:13910970-13910992 ATGTGTAAACTGAAGTTTGATGG - Intronic
1093964326 12:25309338-25309360 TTGTATAAGCAAAAGCTTCTAGG + Intergenic
1095808999 12:46351903-46351925 AAGAAGAAACTAAAGCTTTTAGG - Intergenic
1096218358 12:49810850-49810872 ATTTATAAACAAAAGCTCTTCGG + Intronic
1096918482 12:55058769-55058791 ATGTAGAAGCTAAAACTTGGAGG + Intergenic
1097482405 12:60146140-60146162 ATGTTTAAACTACAGTTAGTTGG - Intergenic
1097606193 12:61757493-61757515 ATTTATAAAATAAAGCTTAGGGG + Intronic
1097651321 12:62300778-62300800 ATGTAAAAACTAAAACTTTTAGG + Intronic
1098023905 12:66182944-66182966 ATGTATACACTATATCTAGTGGG - Intergenic
1098912556 12:76224392-76224414 AAGTATAAAATGAAGCTTGAAGG + Intergenic
1099528950 12:83751761-83751783 GTGTATTAACTAAAACTTCTAGG - Intergenic
1101456996 12:104843587-104843609 CTGCATAATCTAAAGCTTTTTGG - Intronic
1101571641 12:105959107-105959129 ATGTATAAAGCAAAGTGTGTGGG + Intergenic
1102712559 12:114940849-114940871 ATGTATAAGCTAGAGTTTCTTGG - Intergenic
1103653439 12:122451654-122451676 ATGTATTAACTAAAGAGTGTGGG - Intergenic
1103764896 12:123272618-123272640 ATGAATAACCTGAAGGTTGTGGG + Intergenic
1104197880 12:126558528-126558550 ATTTATAAACAAAAACTTGTTGG + Intergenic
1105009484 12:132745937-132745959 AGTTATATACTAAAGTTTGTAGG + Intronic
1106574225 13:30959106-30959128 ATGTATAAACTGACTCTTGAAGG - Intronic
1108439362 13:50434671-50434693 ATAAATAAACTTAAGATTGTAGG - Intronic
1108958894 13:56197330-56197352 ATGAATAAACTAAAGTTTAGAGG + Intergenic
1109632968 13:65077197-65077219 TTGCAGAAACTAAAGTTTGTAGG + Intergenic
1110588817 13:77229342-77229364 ATGAAAAAACTAAGGCTTGAAGG + Intronic
1111392297 13:87612305-87612327 CTGCATAAACTAAAGCTCTTTGG - Intergenic
1111539498 13:89651935-89651957 AGATATAAACTCAAGTTTGTTGG + Intergenic
1111669394 13:91310237-91310259 ATGTAAAAATTATTGCTTGTGGG + Intergenic
1113226945 13:108169346-108169368 TTGGATCAACTACAGCTTGTTGG - Intergenic
1114833214 14:26170706-26170728 ATGTATATTCTAAAGTTGGTAGG + Intergenic
1115280920 14:31662426-31662448 ATAGATAACCTAAAGCATGTGGG - Intronic
1117487121 14:56209646-56209668 ATATATGAACAAAAGCTTTTGGG + Intronic
1118085655 14:62413231-62413253 ATTTTTAAAATAAAACTTGTAGG + Intergenic
1119766738 14:77195250-77195272 ATGGATAAAATAAAGATTGGCGG - Intronic
1120085086 14:80263104-80263126 ATGTATAAAGTACAGCTGGGTGG + Intronic
1121116011 14:91343302-91343324 ATCTGCAAACTACAGCTTGTGGG - Intronic
1123128054 14:105963881-105963903 ATGTATAAAACCAAGCTTGATGG + Intergenic
1124873313 15:33565553-33565575 ATCTATAGAATAAAGATTGTTGG - Intronic
1126452013 15:48818692-48818714 ATGTATAAAATAAAACCTTTGGG + Intergenic
1127254127 15:57274024-57274046 ATGGAGAAACTCAAGCTTGATGG - Intronic
1129557794 15:76531470-76531492 ATGTACCAACTAAAGCAAGTTGG - Intronic
1130110686 15:80961370-80961392 ATTCAAAAACTAAACCTTGTTGG + Intronic
1132138430 15:99367691-99367713 ACGTATAAAGCAAGGCTTGTGGG + Intronic
1139005625 16:62568320-62568342 ATGTGGAAAGTAAAGCTAGTGGG - Intergenic
1140683812 16:77413043-77413065 ATGTATAAAAAAAAACTTGTTGG + Intronic
1140941754 16:79728047-79728069 ATGTAGAAACTGAAACTTTTGGG - Intergenic
1142507879 17:376755-376777 AAGTTTAAAATACAGCTTGTGGG + Intronic
1149145488 17:53486922-53486944 ATGCATAAACTAATGCTTAGTGG - Intergenic
1152925451 17:83085566-83085588 ATGTCTAAACTAAACCATCTTGG + Intronic
1153009997 18:529775-529797 ATGTAGACACTAAGGCTTGAGGG + Intergenic
1153853632 18:9122573-9122595 ATGTATAATCGAAAGCCAGTTGG + Exonic
1155581519 18:27313533-27313555 ATGAGAAAACTGAAGCTTGTTGG + Intergenic
1155744741 18:29340182-29340204 ATGTGTAAACTACAAATTGTGGG - Intergenic
1156155265 18:34294636-34294658 ATATATAAACTGAAACTTGATGG + Intergenic
1156318046 18:35989422-35989444 ATTTATAAACTACAGATAGTTGG - Intronic
1158210628 18:55045568-55045590 AGGGATAAACTAAAGCTTTCCGG - Intergenic
1166595951 19:44050657-44050679 ATTTACAAACTAAAGCATGCTGG + Intergenic
926280153 2:11439491-11439513 ATATATAAACAAAAGCTTTGTGG - Intergenic
929370025 2:41211848-41211870 AAGAACAAACTAAAGCATGTAGG + Intergenic
929642173 2:43593138-43593160 ATGTATAAAATAAATCTGGAAGG + Intronic
929973938 2:46612790-46612812 CTGGATAAACTAAAGATTGGTGG + Intronic
930917696 2:56713868-56713890 ATGAAGAAACTAAGGCCTGTGGG + Intergenic
933064328 2:77774463-77774485 GTTTGTAAACTATAGCTTGTAGG + Intergenic
933326827 2:80848522-80848544 ATGTATAACCTAAGACTTTTGGG - Intergenic
934063158 2:88315471-88315493 ATGCATAAACAAAAGCTCTTTGG - Intergenic
937038539 2:118802799-118802821 AGATACAAACTAAAGTTTGTTGG - Intergenic
941544481 2:166831594-166831616 GGATATAAACTAAAACTTGTAGG - Intergenic
943610370 2:190026185-190026207 ATGGGTAAACTACAGCATGTGGG + Intronic
943840798 2:192577845-192577867 GTTCATAAACTAAACCTTGTTGG - Intergenic
944812467 2:203341080-203341102 ATGTATCAGCAAAAGCTTGAAGG - Intronic
945002588 2:205367382-205367404 AGGTTTAAACTAAAGCATGCAGG + Intronic
945327537 2:208499963-208499985 ATTTATAAACTAAAGAATCTTGG - Intronic
945555789 2:211274028-211274050 CTATATATAGTAAAGCTTGTAGG + Intergenic
945997309 2:216448628-216448650 ATTTTTCAATTAAAGCTTGTTGG + Intronic
946004640 2:216513161-216513183 AGGTATAAACTACATCTTGTAGG - Intronic
947160718 2:227211299-227211321 ATGAATAAACTACAGCTTTATGG - Intronic
947768479 2:232652692-232652714 ATGTAGTAACTAAAACTGGTCGG - Intronic
947920327 2:233865686-233865708 AAGTACAAACTAAACCTTGTTGG + Intergenic
1169673271 20:8128272-8128294 ATTTATATACTAAAGTTTGGAGG - Intergenic
1171238539 20:23547023-23547045 ATGTGTAAACAAAGTCTTGTTGG + Intergenic
1172307004 20:33887974-33887996 ATGTATTAACTCAAGCAAGTAGG - Intergenic
1172602214 20:36191581-36191603 ATGTACACACTAGAGTTTGTAGG + Intronic
1175353996 20:58347924-58347946 TTGTATAAAAGAAAGCTTCTTGG + Intronic
1178553498 21:33564061-33564083 TGGTAGAAACTAAGGCTTGTTGG + Intronic
1179389188 21:40971898-40971920 ATTTATGAAATAAAGCTTGAAGG - Intergenic
1183800386 22:40158576-40158598 TTGTATAACATAAAACTTGTAGG - Intronic
949412559 3:3781875-3781897 ATGTCTCAACTAAACCATGTAGG - Intronic
950464010 3:13142578-13142600 ATCTACAAACTACAGCCTGTAGG + Intergenic
951545901 3:23825006-23825028 AAGTATATACGAAACCTTGTAGG + Intronic
954473641 3:50722697-50722719 ATAAATATACTAAAGCCTGTAGG + Intronic
955664433 3:61335426-61335448 TTGTATAACCTGTAGCTTGTAGG + Intergenic
955866495 3:63389887-63389909 ATGTATAAATAAAAGCTCTTTGG + Intronic
956107105 3:65831239-65831261 AAGGAGAAACTGAAGCTTGTTGG - Intronic
956213222 3:66823307-66823329 ATGTATTAACTTAAGCTCATGGG - Intergenic
959115595 3:102174230-102174252 ATTTATAAAGAAAAGTTTGTTGG + Intronic
959984250 3:112556183-112556205 ATCTATAAAATAACGGTTGTGGG - Intronic
963008654 3:140749625-140749647 ATGGATAAACCAGAGCATGTGGG - Intergenic
963501877 3:146137662-146137684 TTGTATAAACAAGAGATTGTTGG + Intronic
964911751 3:161791077-161791099 ACGAACAAACTAAAGTTTGTAGG - Intergenic
964992504 3:162831392-162831414 ATGTATATTCTACAGCTTTTGGG - Intergenic
965018147 3:163187653-163187675 ATGTATAACTTAAAATTTGTGGG + Intergenic
965388365 3:168073412-168073434 ATGTCTAAAATAAAACTTCTGGG + Intronic
965932024 3:174056103-174056125 ATGTATAACCTAAAGCTTAGAGG + Intronic
966316606 3:178654022-178654044 ATCTATAACCTAAAGCTTCTAGG - Intronic
966532321 3:180994629-180994651 ATTTATAAAATAAAGCTTCTGGG - Intergenic
969908323 4:10418500-10418522 GTGTATAAACTATATTTTGTTGG + Intergenic
971892937 4:32548476-32548498 ATGGATAAAATAAAGATTTTAGG - Intergenic
974194460 4:58554038-58554060 ATCTATAACCTAAAGCATGTTGG - Intergenic
974217072 4:58862294-58862316 ATGAACAAACTAAAACCTGTAGG - Intergenic
974279187 4:59768813-59768835 ATGAATAAAGTAAAGCTTCATGG + Intergenic
975423116 4:74192451-74192473 ATGTATACACTAAAGTTTTAGGG - Intronic
976278514 4:83303162-83303184 CTGAATAAACTCAAGCTTCTAGG + Intronic
981245285 4:142529634-142529656 ATCCATAAACAAAAGCTTTTTGG + Intronic
982190456 4:152849374-152849396 ATTTATAAACAAAAGCTATTAGG + Intronic
982808143 4:159791827-159791849 ATACATAAAATAAAGCTTGGAGG + Intergenic
983738188 4:171090296-171090318 ATATATAAACAAATTCTTGTAGG - Intergenic
983757597 4:171360004-171360026 ATGTGTTAAATGAAGCTTGTTGG + Intergenic
984861984 4:184249043-184249065 ATGTATAACTTAAAGGTAGTAGG + Intergenic
984906277 4:184629404-184629426 GTGCATAAATTCAAGCTTGTCGG + Exonic
985327048 4:188782605-188782627 GTGTCTAAACTAAAACTTCTTGG + Intergenic
987542414 5:19272838-19272860 AAGTGAAAACTAAATCTTGTTGG - Intergenic
987599265 5:20044323-20044345 ATGAATAAAATAAGGCTAGTTGG + Intronic
988663796 5:33302636-33302658 ATGTATAAATTAACCCTTTTTGG - Intergenic
988820547 5:34880517-34880539 AAGTACAAACTAAATCTTGTCGG - Intronic
989222114 5:38978519-38978541 ATGTTAATACTAAAGCTTTTAGG - Intronic
989543041 5:42640298-42640320 ATGGATAAATTGAAGCTTGTGGG - Intronic
989740455 5:44764900-44764922 GTGAACAAACTATAGCTTGTGGG - Intergenic
990101270 5:52192057-52192079 ATATATAAAATAGAGCATGTAGG + Intergenic
990537303 5:56735382-56735404 ATGTATAAACTGAAGCATCAAGG - Intergenic
993490085 5:88536488-88536510 TTTTATAAACTCAAGCTTTTCGG - Intergenic
993535964 5:89087032-89087054 AAGTCTAAAATAAAGCCTGTGGG - Intergenic
993974924 5:94467513-94467535 ATGTTTAAAATTAAGCTTTTAGG - Intronic
995335964 5:111000167-111000189 ATGTAACAGCTAATGCTTGTTGG - Intergenic
995630276 5:114125465-114125487 ATGTATATTCTAAAGCAAGTAGG + Intergenic
997777081 5:136619790-136619812 CTGGATAAACAAAAGCTTTTTGG + Intergenic
997810937 5:136969088-136969110 ATAAATAAACCAAAACTTGTGGG - Intergenic
998380070 5:141717959-141717981 ACGTCTAAACTAAGGCTTGAAGG + Intergenic
998472631 5:142395054-142395076 ATTTATAAAATAAAACTTGAAGG - Intergenic
998798493 5:145843776-145843798 ATGAATAAACTGAAGCATGGAGG + Intergenic
1000042994 5:157499111-157499133 ATGTGGAAACTAGAGCTTATAGG - Intronic
1000948277 5:167449129-167449151 ATGTAAAAGCTAAAGCTTGTAGG + Intronic
1004419431 6:15454769-15454791 ATGTAAAAACTAAGGCATGTTGG - Intronic
1007166271 6:39831032-39831054 ATGAGTAAACTAAGGCATGTGGG + Intronic
1008235781 6:49047587-49047609 ATGGGTAAAGTGAAGCTTGTAGG + Intergenic
1010987274 6:82439417-82439439 ATGTGTAAAAGAAAGCTTGATGG + Intergenic
1011382889 6:86761159-86761181 ATGTATAAACTAGAGGATATTGG - Intergenic
1014242615 6:119034259-119034281 ATGTATATACAAATGCTTGGTGG - Intronic
1014318618 6:119897668-119897690 ATGTAGAAATTAGAGCTGGTAGG + Intergenic
1014468787 6:121788820-121788842 ATTTATAAACTAATACATGTAGG - Intergenic
1014624526 6:123709574-123709596 ATATATAAAGTAAATCTGGTAGG - Intergenic
1015115463 6:129644120-129644142 ATGTCTAGACTTAGGCTTGTTGG - Intronic
1015646363 6:135393291-135393313 ATGTATTATCTATATCTTGTTGG + Intronic
1017267116 6:152460290-152460312 ATTTATAATTTAAAGGTTGTGGG - Intronic
1020480436 7:8653628-8653650 ATGTATATAGAATAGCTTGTTGG - Intronic
1021370190 7:19835221-19835243 ATCTATATACCAAGGCTTGTTGG - Intergenic
1023160165 7:37289206-37289228 ATCTATAAACTAAAGCTCACTGG + Intronic
1024367958 7:48544627-48544649 ATGTATAAGGGAAAGCATGTGGG - Intronic
1027998110 7:85452825-85452847 ATGTATAAACTGAATGTAGTTGG - Intergenic
1030772433 7:113490952-113490974 ATGGATAAACTAAAACATGGGGG - Intergenic
1033180387 7:139172065-139172087 AAGTACAAACTAAACCTTGTTGG + Intronic
1033640177 7:143255931-143255953 ATGTATAAAATAAATATGGTCGG + Intronic
1040589868 8:48781547-48781569 ATGTATAACTTAGAGATTGTGGG - Intergenic
1041357590 8:57016616-57016638 ATGCACAAACTAAAGCTTAGAGG - Intergenic
1041722324 8:60987272-60987294 ATGTCTAAAATAAATCTTGAAGG + Intergenic
1043832760 8:85009565-85009587 ATATAAAAATTAAAGCTTGTTGG + Intergenic
1044114750 8:88321720-88321742 CTACATAAACTAAAGCTTCTAGG + Intronic
1045145523 8:99339850-99339872 AAATATAAACTAAAATTTGTTGG + Intronic
1045440665 8:102206592-102206614 TTGTATAAAGTACAGTTTGTTGG + Exonic
1046270312 8:111888155-111888177 ATGGATAAACTAAAGGTTTCTGG + Intergenic
1046885947 8:119367297-119367319 ATTAACAAACTATAGCTTGTGGG - Intergenic
1047116146 8:121843462-121843484 ATGAATAAATTAAAGATAGTGGG + Intergenic
1047401524 8:124552576-124552598 ATGCATCTACAAAAGCTTGTGGG + Intronic
1048444006 8:134479806-134479828 ATGAATAGACTGAAGGTTGTGGG - Intronic
1050573058 9:6961924-6961946 ATGTATAAATCAAAGACTGTAGG + Intronic
1052378701 9:27745947-27745969 ATATGTAAACAAAACCTTGTTGG + Intergenic
1052616580 9:30850079-30850101 ATGTATTAACTAAATCTTAATGG + Intergenic
1053803161 9:41776778-41776800 ATGTATAAAAGAAAGCATGGTGG - Intergenic
1054142101 9:61538344-61538366 ATGTATAAAAGAAAGCATGGTGG + Intergenic
1054191453 9:61988088-61988110 ATGTATAAAAGAAAGCATGGTGG - Intergenic
1054461860 9:65469524-65469546 ATGTATAAAAGAAAGCATGGTGG + Intergenic
1054646916 9:67599624-67599646 ATGTATAAAAGAAAGCATGGTGG + Intergenic
1055130312 9:72767243-72767265 ATGTATAAAGTAAAACTGGTAGG - Intronic
1057418794 9:94890658-94890680 ATGAAAAAACCAAAGTTTGTGGG - Intronic
1058411409 9:104737214-104737236 ATGTTTTAACTATTGCTTGTTGG - Intergenic
1059645398 9:116261582-116261604 ATGCATAAATTAAAGTTTATTGG - Intronic
1059739890 9:117139776-117139798 ATGTATAAAGGAAAGCTGGGAGG + Intronic
1059836245 9:118157111-118157133 GTGTATAAATTTTAGCTTGTAGG + Intergenic
1060061943 9:120468536-120468558 AATAATAGACTAAAGCTTGTAGG - Intronic
1060622171 9:125077416-125077438 ATGTCTATACAAAATCTTGTAGG - Intronic
1062215387 9:135386316-135386338 ATGAAGAAACTAAGGCTTGGAGG - Intergenic
1186121409 X:6366403-6366425 ATGCAAAAACCAAAGCTTGAAGG - Intergenic
1188378997 X:29468266-29468288 ATTTATAAAGTAAAGATTGAAGG + Intronic
1188494354 X:30767697-30767719 ATTAATAAACTATAGCCTGTGGG - Intergenic
1190010214 X:46778002-46778024 ATGTGTAAACTGAAACTTGGAGG - Intergenic
1194643981 X:96435814-96435836 ATGAATAATCCAAAGCTTGCCGG - Intergenic
1197449932 X:126599878-126599900 AGGAATAAACTTAAGCTTGCTGG + Intergenic
1197490844 X:127115815-127115837 ATGTAAATACTAAAGCTAGCTGG - Intergenic
1198343523 X:135737736-135737758 ATATATAAACTAAATATTTTTGG - Intergenic
1199165981 X:144675871-144675893 CTGTATAAAATAAATATTGTGGG - Intergenic
1199446268 X:147926077-147926099 ATGTATAAACTAAAGCTTGTAGG - Intronic
1199447201 X:147939141-147939163 TTGTAACAAATAAAGCTTGTTGG + Intronic
1199723033 X:150556810-150556832 ATGAATAAACAAAAGATGGTAGG + Intergenic
1199882659 X:151987069-151987091 TTATGTAAACTAAAGTTTGTGGG + Intergenic