ID: 1199447678

View in Genome Browser
Species Human (GRCh38)
Location X:147944775-147944797
Sequence GATTACCCCTGAAACGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 40}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199447678 Original CRISPR GATTACCCCTGAAACGTCTC TGG Intronic
900503395 1:3017414-3017436 GATGACCCCAGAATCATCTCAGG + Intergenic
908000799 1:59677029-59677051 GATTACACCTGAGAGGTCACTGG - Intronic
913072262 1:115310442-115310464 GATTGCCCCTGAAAAGGCCCAGG - Intronic
918092826 1:181312095-181312117 GGTTACCCTGGAAAAGTCTCAGG - Intergenic
1071041771 10:81318014-81318036 GCTTAGCCCTGAAATGTCTTGGG + Intergenic
1074474873 10:113762398-113762420 GCTTCCACCTGAAACGTTTCAGG - Intronic
1079743763 11:24099313-24099335 GATTCCTCATGAAACATCTCAGG + Intergenic
1080183685 11:29453787-29453809 TATTTTCCCTGAAACTTCTCAGG + Intergenic
1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG + Intronic
1085867216 11:80308628-80308650 GATTATGCCTGAAAAGTCACAGG + Intergenic
1085981479 11:81731485-81731507 GATTTCCACTGAAAAGTCTGCGG + Intergenic
1092203936 12:6604340-6604362 AATTAGCCCTAAAATGTCTCTGG + Intronic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1101248551 12:102909198-102909220 CATTACTCCTGAAAACTCTCAGG - Intronic
1103550326 12:121732409-121732431 CTTTACCCCTGAAATGACTCTGG + Intronic
1106779261 13:33040700-33040722 TATTACCCCTGAAACATATTTGG + Intronic
1132045848 15:98562395-98562417 GAATACCTCAGAAATGTCTCAGG + Intergenic
1133180351 16:4049486-4049508 GATTATCCTTAAAAAGTCTCTGG + Intronic
1150701927 17:67454732-67454754 TACTACTCATGAAACGTCTCTGG - Intronic
1152017509 17:77761363-77761385 GGTTCCCCAGGAAACGTCTCTGG - Intergenic
1158876145 18:61736477-61736499 GATTAGCCATGAGACATCTCTGG - Intergenic
1159829067 18:73250453-73250475 GATTTCCTCTGAAACTGCTCTGG - Intronic
1167469250 19:49666258-49666280 GATTTGCCCTGAAACCTCTTGGG + Intronic
933648136 2:84828619-84828641 GTTCACCCCTAAAACCTCTCAGG + Intronic
944475915 2:200106552-200106574 GATTGCCCCAGAAACCTTTCAGG - Intergenic
1173170801 20:40721995-40722017 CATTACTCCCGAAACATCTCTGG - Intergenic
1178706228 21:34875597-34875619 CATTACCCGTGAAACAACTCTGG + Intronic
950275596 3:11657709-11657731 GATTACACCTGAAACTTTTATGG - Intronic
960248788 3:115429054-115429076 AATTGCCCTTGAAATGTCTCAGG + Intergenic
963681877 3:148388421-148388443 GATGATCCCTGAAATGTCTTGGG + Intergenic
964853029 3:161115464-161115486 GATTACCCTTTCAATGTCTCTGG - Intronic
968546212 4:1200336-1200358 GCTCACCCCTGAAGCTTCTCTGG - Intronic
971758805 4:30737026-30737048 GTTTACTCCTCAAAGGTCTCTGG + Intronic
972506641 4:39726048-39726070 GATTGCCTCTGAAACCTCTGGGG + Intronic
975317380 4:72970176-72970198 GCTTCTCCCTGAAACCTCTCAGG + Intergenic
995024763 5:107407264-107407286 GATTAGCCCGAAAACGTCTAAGG + Intronic
1024194886 7:47049126-47049148 GATTATACCTGAAAAGACTCTGG + Intergenic
1024628439 7:51228290-51228312 GATGACCCCTGTAAAGTTTCTGG + Intronic
1033459201 7:141530044-141530066 GATTACTGGTGAAATGTCTCTGG - Intergenic
1058024920 9:100131918-100131940 GAATACCTCTGAAACTTTTCAGG + Intronic
1199447678 X:147944775-147944797 GATTACCCCTGAAACGTCTCTGG + Intronic