ID: 1199448599

View in Genome Browser
Species Human (GRCh38)
Location X:147954778-147954800
Sequence ATCCATAATGATCTGTAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199448599_1199448601 6 Left 1199448599 X:147954778-147954800 CCAGATTACAGATCATTATGGAT No data
Right 1199448601 X:147954807-147954829 GATTTTAACAGTGGCCACCATGG No data
1199448599_1199448600 -3 Left 1199448599 X:147954778-147954800 CCAGATTACAGATCATTATGGAT No data
Right 1199448600 X:147954798-147954820 GATCATTGTGATTTTAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199448599 Original CRISPR ATCCATAATGATCTGTAATC TGG (reversed) Intergenic
No off target data available for this crispr