ID: 1199455677

View in Genome Browser
Species Human (GRCh38)
Location X:148025428-148025450
Sequence AACAGGTAGCTGAGACTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199455677_1199455681 20 Left 1199455677 X:148025428-148025450 CCTGTTAGTCTCAGCTACCTGTT 0: 1
1: 0
2: 1
3: 18
4: 180
Right 1199455681 X:148025471-148025493 GTGTTAGAAGAGGTTGAGAGAGG 0: 1
1: 0
2: 1
3: 18
4: 265
1199455677_1199455680 10 Left 1199455677 X:148025428-148025450 CCTGTTAGTCTCAGCTACCTGTT 0: 1
1: 0
2: 1
3: 18
4: 180
Right 1199455680 X:148025461-148025483 GCACGATGTAGTGTTAGAAGAGG 0: 1
1: 0
2: 0
3: 4
4: 64
1199455677_1199455682 21 Left 1199455677 X:148025428-148025450 CCTGTTAGTCTCAGCTACCTGTT 0: 1
1: 0
2: 1
3: 18
4: 180
Right 1199455682 X:148025472-148025494 TGTTAGAAGAGGTTGAGAGAGGG 0: 1
1: 0
2: 0
3: 29
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199455677 Original CRISPR AACAGGTAGCTGAGACTAAC AGG (reversed) Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
902535425 1:17116939-17116961 CACAGCCAGCTGAGACTCACTGG - Intronic
905585052 1:39110359-39110381 CCCAAGTAGCTGGGACTAACAGG + Intronic
906324073 1:44833344-44833366 AGCAGGCAGCAAAGACTAACAGG - Intronic
906494958 1:46298737-46298759 AGCAGGGAGCTGATACTAGCAGG - Intronic
907147683 1:52250832-52250854 CCCAAGTAGCTGGGACTAACAGG + Intronic
908158743 1:61385110-61385132 CACAGGTAGCTGGGATTTACAGG - Intronic
908504637 1:64784250-64784272 CCCAAGTAGCTGAGACTAACAGG - Intronic
909964080 1:81885950-81885972 AACAGTTAACTGAAATTAACTGG + Intronic
910476845 1:87616575-87616597 AACATGAACCTGAGAGTAACCGG + Intergenic
911486015 1:98505848-98505870 AACAAGTAACTGACCCTAACAGG + Intergenic
911864394 1:102998290-102998312 ACCAGGTAGCTGTTACTTACAGG + Exonic
914698131 1:150104713-150104735 ACCAAGTAGCTGAGACTATAGGG + Intronic
914762244 1:150608371-150608393 GCCAAGTAGCTGGGACTAACAGG + Intronic
917571136 1:176266672-176266694 CTCAGGTAGCTGAGACTTACAGG + Intergenic
918000371 1:180488697-180488719 CCCAGGTAGCTGAGACTACAGGG + Intronic
918383420 1:183981530-183981552 CCCAAGTAGCTGGGACTAACAGG - Intronic
921211783 1:212907192-212907214 GACAAGAAGCTGACACTAACAGG - Intergenic
924528441 1:244872587-244872609 CCCAAGTAGCTGAGACTTACAGG + Intergenic
924677004 1:246189312-246189334 ATAAGGAAGCTGAGACTCACAGG + Intronic
924774207 1:247104307-247104329 AACTAGCAGCGGAGACTAACAGG + Exonic
1063867974 10:10387939-10387961 GACAGGTAGCTTAGACCAACAGG - Intergenic
1064340715 10:14483047-14483069 TCCAAGTAGCTGGGACTAACAGG + Intergenic
1068721391 10:60250288-60250310 AAAATGTGGCTGAGACAAACTGG + Intronic
1069998126 10:72355587-72355609 AACAGGTAGATGTGACTGTCTGG + Intergenic
1072318727 10:94228205-94228227 GCCAGGTAGCTGAGGCTAAAAGG - Intronic
1072593287 10:96847117-96847139 CCCAGGTAGCTGGGACCAACAGG - Intronic
1072670807 10:97427564-97427586 AACAGGTAGGTGTGAGGAACTGG + Intronic
1074168424 10:110907388-110907410 CCCGAGTAGCTGAGACTAACAGG - Intronic
1075565880 10:123503856-123503878 CCCAAGTAGCTGAGACTTACAGG + Intergenic
1078225570 11:9388601-9388623 CCCAGGTAGCTGAGACTACGGGG + Intronic
1079086294 11:17447548-17447570 CCCAGGTAGCTGGGACTAAAGGG + Intronic
1084854691 11:71975315-71975337 AAGAGGTAGATGAGACTCAAAGG - Intronic
1085144316 11:74179368-74179390 CTCAAGTAGCTGGGACTAACAGG - Intronic
1087735286 11:101826169-101826191 CCCAGGTAGCTGGGACTTACAGG - Intronic
1087972959 11:104508120-104508142 CCCAAGTAGCTGGGACTAACAGG + Intergenic
1090280200 11:125449164-125449186 CCCAAGTAGCTGAGACTTACAGG + Intronic
1095817594 12:46441422-46441444 CCCAAGTAGCTGAGACTAACAGG + Intergenic
1100993144 12:100271953-100271975 AGCAGGTAGCTGAAAGGAACTGG - Intronic
1101815257 12:108141176-108141198 CCCAAGTAGCTGAGACTTACAGG + Intronic
1102832245 12:116013843-116013865 AACAGGGAGATGAGACAACCAGG - Intronic
1103367103 12:120391238-120391260 AAAAGATACCTGAGACTATCTGG + Intergenic
1104313895 12:127679416-127679438 AAGAGATAGCTGAGAGTGACAGG - Intergenic
1104371065 12:128224375-128224397 AACATGAAGCTGAGACCTACTGG + Intergenic
1108216277 13:48187938-48187960 AAAAGGTAGAGGAGAGTAACTGG + Intergenic
1113204615 13:107901954-107901976 AAGAGGTAGGTGAGACTTATAGG - Intergenic
1113233111 13:108237533-108237555 AACAAGTATCAGAGACTAAATGG - Intergenic
1113482218 13:110629446-110629468 AACAGGGAGCAGATGCTAACGGG - Intronic
1114882937 14:26809345-26809367 AAGTGGTAGCAGAAACTAACAGG - Intergenic
1115066612 14:29269569-29269591 AAGAAGTAGCTGGGACTAAGGGG + Intergenic
1118419192 14:65581366-65581388 ACCAGGTACCTGAGACTAACTGG - Intronic
1119350223 14:73958493-73958515 AACAGATAGCTGGGCCTCACAGG + Intronic
1120432518 14:84437077-84437099 ATCTGGTAACTGAGACTAAAAGG + Intergenic
1120605737 14:86574988-86575010 AACTGGTAGGTGTGACTAAAAGG + Intergenic
1122575787 14:102740750-102740772 CCCAAGTAGCTGAGACTTACAGG + Intergenic
1125114842 15:36078374-36078396 AAGAGGAAACTGAGACTAACAGG - Intergenic
1126137692 15:45408134-45408156 AACAGGTAGTTGACAATAAAAGG + Intronic
1126139535 15:45425988-45426010 CTCAAGTAGCTGGGACTAACAGG - Intergenic
1126166757 15:45660030-45660052 AAAAGGTAGCTGACACTAGGAGG + Intronic
1127704093 15:61530208-61530230 ATCAGATTGCTGAGACTAAATGG + Intergenic
1128355073 15:66920674-66920696 AACACGTAGCTGAGACGCAAGGG + Intergenic
1129612563 15:77072104-77072126 CACAGGATGCTGAGATTAACAGG - Intronic
1130866972 15:87941575-87941597 AACGGGTAGCTAAGATTATCTGG + Intronic
1131269372 15:90937219-90937241 CACAGGTAGCTGGGACTACAAGG - Intronic
1131274846 15:90972257-90972279 CCCATGTAGCTGAGACTTACGGG - Intronic
1131868360 15:96735398-96735420 AACTGGGAGGTTAGACTAACTGG + Intergenic
1131897028 15:97044858-97044880 CCCATGTAGCTGGGACTAACAGG - Intergenic
1134226536 16:12395405-12395427 AAATGGTAGATGAGACCAACGGG - Intronic
1134770642 16:16806128-16806150 AACAGGCAGCTGAGAGTGAGAGG - Intergenic
1134888902 16:17820803-17820825 AATGGGGAGCTGAGACCAACTGG + Intergenic
1137277204 16:46943516-46943538 AACAGGAGGCTGAGACTTGCTGG - Intergenic
1138611952 16:58132260-58132282 CCCAGTTAGCTGAGACTTACAGG - Intergenic
1139703495 16:68724500-68724522 CCCGAGTAGCTGAGACTAACAGG - Intergenic
1139798147 16:69499529-69499551 CCCAAGTAGCTGAGACTAACAGG - Intergenic
1139822769 16:69733877-69733899 CCCAAGTAGCTGGGACTAACAGG - Intergenic
1147454647 17:40529602-40529624 CCTAAGTAGCTGAGACTAACAGG + Intergenic
1148263178 17:46202051-46202073 CCCAGGTAGCTGGTACTAACTGG - Intronic
1148719863 17:49743803-49743825 CCCAAGTAGCTGGGACTAACAGG - Intronic
1152585293 17:81186623-81186645 CCCAGGTAGCTGGGACTACCTGG - Intergenic
1154198644 18:12284207-12284229 GGCAGGTAGCGGAGACTCACTGG - Intergenic
1155521485 18:26673240-26673262 CCCAGGTAGCTGAGACTACATGG + Intergenic
1162764012 19:12907109-12907131 AAAAGTTAGCTGTGACTCACAGG - Intronic
1165032851 19:33010804-33010826 CACAAGTAGCTGGGACTAACAGG + Intronic
1165752004 19:38265837-38265859 AACAGTTAACTCAGACTAGCTGG + Intronic
1166714430 19:44957573-44957595 AAGAAGTAGCTGAGACCACCAGG - Intronic
1166776490 19:45315966-45315988 CCCAAGTAGCTGGGACTAACAGG + Intronic
1167172826 19:47844697-47844719 CCCAAGTAGCTGAGACTTACAGG + Intergenic
1167806761 19:51792247-51792269 AACAACTAACTGAGACTGACAGG - Intronic
927548838 2:23978836-23978858 CCCAAGTAGCTGCGACTAACAGG - Intronic
927733734 2:25499336-25499358 ACCAGTTAGCTGAGACACACAGG - Intronic
928955179 2:36858886-36858908 ATCAGTTAGCAGAGAGTAACTGG + Intronic
929032321 2:37660712-37660734 AAAAGGAAGCTGAGACCAAAGGG + Intronic
929509881 2:42558363-42558385 CCCAAGTAGCTGGGACTAACTGG + Intronic
929672550 2:43888740-43888762 AACTGGTAGCTAAGACTGCCAGG + Intronic
930192975 2:48479214-48479236 AACAGGTAGCTGGGAGCAAGAGG + Intronic
930450113 2:51525266-51525288 CCCAAGTAGCTGAGATTAACAGG + Intergenic
930604913 2:53483759-53483781 AAAATGAAGCTGAGACTTACTGG + Intergenic
932783853 2:74582193-74582215 CACAGGTAGCTGGGATTAGCTGG + Intronic
937394018 2:121518751-121518773 CCCAAGTAGCTGGGACTAACAGG - Intronic
938065434 2:128279664-128279686 TCCAGGTAGCTGGGACTACCTGG - Intronic
938741069 2:134232631-134232653 ACCAGGAAGTTGATACTAACAGG + Intronic
939603857 2:144228118-144228140 CACAGGTAACTGATACTATCAGG - Intronic
940335766 2:152525687-152525709 CACAGGAAGCTGAGTCTAAGTGG - Intronic
941042112 2:160634333-160634355 AAAAGCTAACTGAGGCTAACTGG + Intergenic
943731417 2:191306920-191306942 ACCAGTTATCTGACACTAACTGG + Intronic
945213137 2:207404695-207404717 AACAGAAAGCTGAGGCTCACAGG - Intergenic
945765847 2:213976921-213976943 CACAGTTAGCTGAGCCTAACAGG + Intronic
948360480 2:237416815-237416837 ATCAGGTAGCAGAGAGGAACTGG - Intergenic
948886348 2:240887041-240887063 AACAGGTGGCTGAGACCAGGTGG + Exonic
1169597615 20:7218603-7218625 CCCAAGTAGCTGAGATTAACAGG - Intergenic
1171207449 20:23292147-23292169 AACAGCTAGCTGAGAATACATGG + Intergenic
1173151899 20:40573687-40573709 ACCAAGTAGCTGGGACTAACAGG - Intergenic
1173319925 20:41978233-41978255 ATCAGGGAACTGAGGCTAACAGG + Intergenic
1174147874 20:48464722-48464744 CCCAAGTAGCTGGGACTAACAGG + Intergenic
1175343577 20:58252051-58252073 AACAGTTACCTGAGTCAAACTGG - Intergenic
1178516016 21:33247792-33247814 AACAGGAAGCTGAGACCAGATGG - Intronic
1179587821 21:42384863-42384885 ACCAGGTAACTGAAACTTACAGG - Intronic
1183007239 22:34913670-34913692 ACCAGGTTGCTGTGACAAACTGG + Intergenic
1183876555 22:40787163-40787185 AAGAGGTAGCTGAGAATAAAGGG + Intronic
1184611415 22:45606385-45606407 ATCAGGGAGCAAAGACTAACGGG - Intergenic
950584103 3:13880463-13880485 AACAGGGAGCTGGGGCTGACAGG + Intergenic
952788515 3:37178660-37178682 CCCAAGTAGCTGAGACTAACAGG - Intronic
953635760 3:44662580-44662602 ATCAGGAAGCTGAGAATATCAGG + Intergenic
953708478 3:45249072-45249094 AACAAGTTCCTAAGACTAACAGG + Intergenic
956519915 3:70092817-70092839 AAGAGGTACCTGAGACAGACAGG + Intergenic
956764207 3:72470441-72470463 AAAGGGTAGCTGAGACTCATAGG - Intergenic
959110422 3:102116118-102116140 TACAGGTAGCTGAGCCTAGTGGG - Intronic
960273031 3:115695226-115695248 AACTGGAACCTTAGACTAACTGG + Intronic
960462742 3:117956925-117956947 TAAAGGTTGCTGAGACTAAAGGG - Intergenic
960840224 3:121950334-121950356 AAAAGGTAGAAGAGACTAAATGG - Intergenic
963588521 3:147226619-147226641 CCCAGGTAGCTGAGACTACAGGG - Intergenic
963649594 3:147962057-147962079 AACATGTAGTTGGGACTGACTGG - Intergenic
964211906 3:154237857-154237879 AACAGGTGCCTTTGACTAACAGG + Intronic
964747718 3:160027379-160027401 AACAGGTAGGTAAGACTAGGGGG + Intronic
965869191 3:173246318-173246340 AACATGTAGTTGAGACTACTAGG - Intergenic
966810170 3:183836862-183836884 GCCAAGTAGCTGGGACTAACAGG + Intronic
967129914 3:186460805-186460827 CCCAAGTAGCTGGGACTAACAGG + Intergenic
967169835 3:186814398-186814420 AGAAGGTGGCTGAGAATAACTGG - Intergenic
972348825 4:38216849-38216871 CCCAAGTAGCTGAGACTAACAGG + Intergenic
972505988 4:39720619-39720641 AACCGGTAACTGATACTTACAGG + Intronic
975033368 4:69652065-69652087 ATCAGGCAGATGAGACTGACGGG - Intronic
975326787 4:73067714-73067736 CCCAGGTAGCTGGGATTAACAGG - Intronic
978506612 4:109464405-109464427 CACAAGTAGCTGGGACTACCAGG + Intronic
980608544 4:135125334-135125356 ACAAAGTAGCTGGGACTAACAGG - Intergenic
983417718 4:167479947-167479969 AACAGGTAGTTGATCCTACCAGG - Intergenic
983997481 4:174202599-174202621 AAAAGGTAGGTGAGACCAAGAGG - Intergenic
991364446 5:65853826-65853848 CCCAAGTAGCTGAGACTATCTGG + Intronic
997292261 5:132746655-132746677 CTCAAGTAGCTGAGACTTACAGG - Intergenic
999285420 5:150391611-150391633 AACAGGAGGCTGAGCCTCACTGG - Exonic
1002879078 6:1235611-1235633 ACTAGCTAGCTGACACTAACAGG + Intergenic
1004465863 6:15884146-15884168 CACAGGTAGCTGGGACTCACAGG - Intergenic
1004828187 6:19446971-19446993 ATCAGGGAGCTGAGACTATGGGG - Intergenic
1007979634 6:46138333-46138355 AACAGGCAGCTGATCCTACCTGG - Intronic
1008648024 6:53535122-53535144 AACAAGTAGCTGGGACTTACAGG - Intronic
1008911573 6:56739545-56739567 AAAAGGAAGCTGAGACCTACTGG + Intronic
1011652643 6:89521095-89521117 AAAATGAAGCTGTGACTAACAGG - Intronic
1011972905 6:93250511-93250533 AACAGCTACCTGATACTGACTGG - Intronic
1012136814 6:95567912-95567934 CCCAGGTAGCTGGGATTAACAGG + Intergenic
1012844203 6:104368873-104368895 CCCAGGTAGCTAAGACTAACAGG - Intergenic
1013118404 6:107120487-107120509 CTCAGGTAGCTGAGACTACAAGG + Intergenic
1015610903 6:135016878-135016900 AACAGGTAGATTAAAATAACAGG + Intronic
1017692902 6:156984641-156984663 AACATTTAGCTGAGTCTAAATGG + Intronic
1020103780 7:5411082-5411104 AGCAAGTAGCTGGGATTAACAGG - Intronic
1021326158 7:19272396-19272418 ACAAGCTGGCTGAGACTAACTGG + Intergenic
1022071374 7:26918792-26918814 AAGAGGTAGCATAGAATAACAGG + Intronic
1022551097 7:31239313-31239335 CCCAAGTAGCTGAGACTTACAGG - Intergenic
1023619391 7:42054232-42054254 AACATGTTGCAGAGAATAACTGG + Intronic
1024475182 7:49801781-49801803 AACAGGAAACTGAGACTCAGAGG - Intronic
1025935852 7:66036280-66036302 CCCAAGTAGCTGAGATTAACAGG + Intergenic
1027547563 7:79547720-79547742 AACACTTAGCTGATACTAACTGG + Intergenic
1039564192 8:38538273-38538295 CCCAAGTAGCTGAGATTAACAGG + Intergenic
1040049365 8:42997029-42997051 CACAAGTAGCTGGGACTTACAGG + Intronic
1040298252 8:46174456-46174478 CACAGGCAGCAGAGACTCACTGG + Intergenic
1041924311 8:63220849-63220871 AACAGGAAGATGAGATTAAATGG - Intergenic
1043310742 8:78856519-78856541 AACAGGAAGCTGAGAAGTACTGG + Intergenic
1043456535 8:80417709-80417731 CCCAGGTAGCTGGGACTTACAGG - Intergenic
1045520203 8:102896761-102896783 AACATGCATCTGAGACTAATAGG - Intronic
1045960567 8:107963398-107963420 CCCAGGTAGCTGGGACCAACAGG - Intronic
1048555512 8:135472030-135472052 ATGAGGAAGCTGAGACCAACTGG - Intronic
1049058383 8:140256882-140256904 AACACTTAACTGAGACTCACTGG - Intronic
1050632694 9:7577454-7577476 AACTGGAAGAAGAGACTAACTGG + Intergenic
1054774700 9:69115282-69115304 GTCAAGTAGCTGGGACTAACAGG + Intergenic
1055555461 9:77469079-77469101 TACAGGGACCTGAGACTAACAGG - Intronic
1057899591 9:98937872-98937894 AACAGGTAGCCCAGACTCCCAGG - Intergenic
1060341892 9:122784820-122784842 AACAGGTAGTTGAGTAGAACTGG + Intergenic
1060519015 9:124283381-124283403 CACAGTTAGCTGAGACGACCGGG + Intronic
1060609475 9:124949587-124949609 CCCAGGTAGCTGGGACTAATAGG + Intronic
1061053683 9:128210484-128210506 CCCAAGTAGCTGAGACTAACAGG + Intronic
1061346130 9:130026839-130026861 CACAAGTAGCTAGGACTAACAGG - Intronic
1061712302 9:132496947-132496969 AACAGATAGCTAAGAGTCACTGG + Intronic
1062690172 9:137837564-137837586 AACAGGCAGGTGAGTCTCACAGG + Intronic
1186484435 X:9923227-9923249 TACAGTTAGCAGAGACGAACTGG + Intronic
1187919840 X:24190934-24190956 AACAGCTAGCAGTGACTGACAGG - Intronic
1189823453 X:44893048-44893070 ACCAAGTAGCTGGGACTTACAGG - Intronic
1192444790 X:71202828-71202850 CACAAGTAGCTGAGACTACAGGG - Intergenic
1197124838 X:122932060-122932082 CACGAGTAGCTGGGACTAACAGG - Intergenic
1199455677 X:148025428-148025450 AACAGGTAGCTGAGACTAACAGG - Intronic
1202269328 Y:23055098-23055120 AACAGGTAAGTGACACAAACAGG + Intergenic
1202422322 Y:24688844-24688866 AACAGGTAAGTGACACAAACAGG + Intergenic
1202448467 Y:24981242-24981264 AACAGGTAAGTGACACAAACAGG - Intergenic