ID: 1199457509

View in Genome Browser
Species Human (GRCh38)
Location X:148045030-148045052
Sequence AGGGAGAGCACAGTGGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199457509_1199457518 27 Left 1199457509 X:148045030-148045052 CCCACAACCACTGTGCTCTCCCT No data
Right 1199457518 X:148045080-148045102 TGTGCCGTGTGACCACTGCCGGG No data
1199457509_1199457512 -8 Left 1199457509 X:148045030-148045052 CCCACAACCACTGTGCTCTCCCT No data
Right 1199457512 X:148045045-148045067 CTCTCCCTCCATCAAGTGCGTGG No data
1199457509_1199457517 26 Left 1199457509 X:148045030-148045052 CCCACAACCACTGTGCTCTCCCT No data
Right 1199457517 X:148045079-148045101 ATGTGCCGTGTGACCACTGCCGG No data
1199457509_1199457519 28 Left 1199457509 X:148045030-148045052 CCCACAACCACTGTGCTCTCCCT No data
Right 1199457519 X:148045081-148045103 GTGCCGTGTGACCACTGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199457509 Original CRISPR AGGGAGAGCACAGTGGTTGT GGG (reversed) Intergenic
No off target data available for this crispr