ID: 1199458741

View in Genome Browser
Species Human (GRCh38)
Location X:148059536-148059558
Sequence GTCCCAAGACTGCACATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199458732_1199458741 27 Left 1199458732 X:148059486-148059508 CCTTGGCCCCATTTAGCCATGGC No data
Right 1199458741 X:148059536-148059558 GTCCCAAGACTGCACATAGCAGG No data
1199458734_1199458741 21 Left 1199458734 X:148059492-148059514 CCCCATTTAGCCATGGCTGGAGC No data
Right 1199458741 X:148059536-148059558 GTCCCAAGACTGCACATAGCAGG No data
1199458735_1199458741 20 Left 1199458735 X:148059493-148059515 CCCATTTAGCCATGGCTGGAGCT No data
Right 1199458741 X:148059536-148059558 GTCCCAAGACTGCACATAGCAGG No data
1199458737_1199458741 11 Left 1199458737 X:148059502-148059524 CCATGGCTGGAGCTGCTGAGACA No data
Right 1199458741 X:148059536-148059558 GTCCCAAGACTGCACATAGCAGG No data
1199458736_1199458741 19 Left 1199458736 X:148059494-148059516 CCATTTAGCCATGGCTGGAGCTG 0: 169
1: 413
2: 972
3: 1366
4: 1471
Right 1199458741 X:148059536-148059558 GTCCCAAGACTGCACATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199458741 Original CRISPR GTCCCAAGACTGCACATAGC AGG Intergenic
No off target data available for this crispr