ID: 1199460399

View in Genome Browser
Species Human (GRCh38)
Location X:148077492-148077514
Sequence GACAGTAAGGTGATTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199460399_1199460402 17 Left 1199460399 X:148077492-148077514 CCTGTCAGAATCACCTTACTGTC No data
Right 1199460402 X:148077532-148077554 TTCACAAGCTGAAATACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199460399 Original CRISPR GACAGTAAGGTGATTCTGAC AGG (reversed) Intergenic
No off target data available for this crispr