ID: 1199461850

View in Genome Browser
Species Human (GRCh38)
Location X:148093868-148093890
Sequence GGCTGGCTTTCTTGTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199461850_1199461859 9 Left 1199461850 X:148093868-148093890 CCAGTCCCACAAGAAAGCCAGCC No data
Right 1199461859 X:148093900-148093922 CCCCATTGGGTGTTTAGCTTGGG No data
1199461850_1199461855 -4 Left 1199461850 X:148093868-148093890 CCAGTCCCACAAGAAAGCCAGCC No data
Right 1199461855 X:148093887-148093909 AGCCTTGCTTTCTCCCCATTGGG No data
1199461850_1199461857 8 Left 1199461850 X:148093868-148093890 CCAGTCCCACAAGAAAGCCAGCC No data
Right 1199461857 X:148093899-148093921 TCCCCATTGGGTGTTTAGCTTGG No data
1199461850_1199461854 -5 Left 1199461850 X:148093868-148093890 CCAGTCCCACAAGAAAGCCAGCC No data
Right 1199461854 X:148093886-148093908 CAGCCTTGCTTTCTCCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199461850 Original CRISPR GGCTGGCTTTCTTGTGGGAC TGG (reversed) Intergenic