ID: 1199464453

View in Genome Browser
Species Human (GRCh38)
Location X:148120315-148120337
Sequence AGGGAGAGCAAAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199464446_1199464453 22 Left 1199464446 X:148120270-148120292 CCTCAGGCAGGGCAGTGTGCTGC No data
Right 1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG No data
1199464445_1199464453 27 Left 1199464445 X:148120265-148120287 CCTATCCTCAGGCAGGGCAGTGT No data
Right 1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG No data
1199464444_1199464453 28 Left 1199464444 X:148120264-148120286 CCCTATCCTCAGGCAGGGCAGTG No data
Right 1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199464453 Original CRISPR AGGGAGAGCAAAGTGATTGT GGG Intergenic
No off target data available for this crispr