ID: 1199466588

View in Genome Browser
Species Human (GRCh38)
Location X:148144831-148144853
Sequence GACTCTCTGGAGTCAAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199466588_1199466595 21 Left 1199466588 X:148144831-148144853 CCAGCCCTTGACTCCAGAGAGTC No data
Right 1199466595 X:148144875-148144897 TCATAGCCTTCTTTCCCCCGGGG No data
1199466588_1199466593 19 Left 1199466588 X:148144831-148144853 CCAGCCCTTGACTCCAGAGAGTC No data
Right 1199466593 X:148144873-148144895 ACTCATAGCCTTCTTTCCCCCGG No data
1199466588_1199466592 -5 Left 1199466588 X:148144831-148144853 CCAGCCCTTGACTCCAGAGAGTC No data
Right 1199466592 X:148144849-148144871 GAGTCAGAACATGTCAGATATGG No data
1199466588_1199466594 20 Left 1199466588 X:148144831-148144853 CCAGCCCTTGACTCCAGAGAGTC No data
Right 1199466594 X:148144874-148144896 CTCATAGCCTTCTTTCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199466588 Original CRISPR GACTCTCTGGAGTCAAGGGC TGG (reversed) Intergenic
No off target data available for this crispr