ID: 1199466976

View in Genome Browser
Species Human (GRCh38)
Location X:148149112-148149134
Sequence GTGCAAAGCCACAATAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199466975_1199466976 17 Left 1199466975 X:148149072-148149094 CCACATGTGAAGATACATTTAGC No data
Right 1199466976 X:148149112-148149134 GTGCAAAGCCACAATAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199466976 Original CRISPR GTGCAAAGCCACAATAATTA AGG Intergenic
No off target data available for this crispr