ID: 1199467197

View in Genome Browser
Species Human (GRCh38)
Location X:148151753-148151775
Sequence CACATACCAACTCTGTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199467190_1199467197 23 Left 1199467190 X:148151707-148151729 CCCCTACAATTCACAGAGCTCTA No data
Right 1199467197 X:148151753-148151775 CACATACCAACTCTGTAGGTGGG No data
1199467192_1199467197 21 Left 1199467192 X:148151709-148151731 CCTACAATTCACAGAGCTCTATT No data
Right 1199467197 X:148151753-148151775 CACATACCAACTCTGTAGGTGGG No data
1199467194_1199467197 -5 Left 1199467194 X:148151735-148151757 CCACATCTTCTCATTTAACACAT No data
Right 1199467197 X:148151753-148151775 CACATACCAACTCTGTAGGTGGG No data
1199467191_1199467197 22 Left 1199467191 X:148151708-148151730 CCCTACAATTCACAGAGCTCTAT No data
Right 1199467197 X:148151753-148151775 CACATACCAACTCTGTAGGTGGG No data
1199467193_1199467197 -4 Left 1199467193 X:148151734-148151756 CCCACATCTTCTCATTTAACACA No data
Right 1199467197 X:148151753-148151775 CACATACCAACTCTGTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199467197 Original CRISPR CACATACCAACTCTGTAGGT GGG Intergenic
No off target data available for this crispr