ID: 1199472433

View in Genome Browser
Species Human (GRCh38)
Location X:148209835-148209857
Sequence CAAAATACTGATAGTTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199472431_1199472433 4 Left 1199472431 X:148209808-148209830 CCTAAAGACTTGTTGAATGGCTT 0: 59
1: 1572
2: 1896
3: 1364
4: 924
Right 1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG No data
1199472430_1199472433 5 Left 1199472430 X:148209807-148209829 CCCTAAAGACTTGTTGAATGGCT No data
Right 1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199472433 Original CRISPR CAAAATACTGATAGTTATTA TGG Intergenic
No off target data available for this crispr