ID: 1199473995 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:148226137-148226159 |
Sequence | CTGGTTCCTCAGATGGAGTT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1199473989_1199473995 | 20 | Left | 1199473989 | X:148226094-148226116 | CCTTTAAGTTTCCATTCAAAATG | No data | ||
Right | 1199473995 | X:148226137-148226159 | CTGGTTCCTCAGATGGAGTTAGG | No data | ||||
1199473990_1199473995 | 9 | Left | 1199473990 | X:148226105-148226127 | CCATTCAAAATGACTGTTGTCAA | No data | ||
Right | 1199473995 | X:148226137-148226159 | CTGGTTCCTCAGATGGAGTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1199473995 | Original CRISPR | CTGGTTCCTCAGATGGAGTT AGG | Intergenic | ||
No off target data available for this crispr |