ID: 1199473995

View in Genome Browser
Species Human (GRCh38)
Location X:148226137-148226159
Sequence CTGGTTCCTCAGATGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199473989_1199473995 20 Left 1199473989 X:148226094-148226116 CCTTTAAGTTTCCATTCAAAATG No data
Right 1199473995 X:148226137-148226159 CTGGTTCCTCAGATGGAGTTAGG No data
1199473990_1199473995 9 Left 1199473990 X:148226105-148226127 CCATTCAAAATGACTGTTGTCAA No data
Right 1199473995 X:148226137-148226159 CTGGTTCCTCAGATGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199473995 Original CRISPR CTGGTTCCTCAGATGGAGTT AGG Intergenic
No off target data available for this crispr