ID: 1199474126

View in Genome Browser
Species Human (GRCh38)
Location X:148227463-148227485
Sequence ATTTGAAGCAAGGCAGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199474126_1199474129 -7 Left 1199474126 X:148227463-148227485 CCAACTCCTGCCTTGCTTCAAAT No data
Right 1199474129 X:148227479-148227501 TTCAAATCTGTTTCCAGTGCAGG No data
1199474126_1199474132 12 Left 1199474126 X:148227463-148227485 CCAACTCCTGCCTTGCTTCAAAT No data
Right 1199474132 X:148227498-148227520 CAGGCTGCTGGTTTTCCATGAGG No data
1199474126_1199474133 16 Left 1199474126 X:148227463-148227485 CCAACTCCTGCCTTGCTTCAAAT No data
Right 1199474133 X:148227502-148227524 CTGCTGGTTTTCCATGAGGATGG No data
1199474126_1199474130 0 Left 1199474126 X:148227463-148227485 CCAACTCCTGCCTTGCTTCAAAT No data
Right 1199474130 X:148227486-148227508 CTGTTTCCAGTGCAGGCTGCTGG No data
1199474126_1199474134 17 Left 1199474126 X:148227463-148227485 CCAACTCCTGCCTTGCTTCAAAT No data
Right 1199474134 X:148227503-148227525 TGCTGGTTTTCCATGAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199474126 Original CRISPR ATTTGAAGCAAGGCAGGAGT TGG (reversed) Intergenic
No off target data available for this crispr