ID: 1199489252

View in Genome Browser
Species Human (GRCh38)
Location X:148380490-148380512
Sequence CAGGGGAGTCAGCACCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199489245_1199489252 30 Left 1199489245 X:148380437-148380459 CCAAAAGAGATAACCAAACATAG No data
Right 1199489252 X:148380490-148380512 CAGGGGAGTCAGCACCAAGAAGG No data
1199489247_1199489252 17 Left 1199489247 X:148380450-148380472 CCAAACATAGCAGCAAAGGAAAG No data
Right 1199489252 X:148380490-148380512 CAGGGGAGTCAGCACCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199489252 Original CRISPR CAGGGGAGTCAGCACCAAGA AGG Intergenic
No off target data available for this crispr