ID: 1199490477

View in Genome Browser
Species Human (GRCh38)
Location X:148393438-148393460
Sequence CTTTGGATAGGTACCTAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199490477_1199490481 0 Left 1199490477 X:148393438-148393460 CCCTACTAGGTACCTATCCAAAG No data
Right 1199490481 X:148393461-148393483 ACAAGAAACCAATATATCAAAGG No data
1199490477_1199490482 1 Left 1199490477 X:148393438-148393460 CCCTACTAGGTACCTATCCAAAG No data
Right 1199490482 X:148393462-148393484 CAAGAAACCAATATATCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199490477 Original CRISPR CTTTGGATAGGTACCTAGTA GGG (reversed) Intergenic
No off target data available for this crispr