ID: 1199490855

View in Genome Browser
Species Human (GRCh38)
Location X:148399024-148399046
Sequence CAGTGGGACCAGTAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199490855_1199490860 -6 Left 1199490855 X:148399024-148399046 CCTTCTACCTACTGGTCCCACTG No data
Right 1199490860 X:148399041-148399063 CCACTGGAATAAATCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199490855 Original CRISPR CAGTGGGACCAGTAGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr