ID: 1199491783

View in Genome Browser
Species Human (GRCh38)
Location X:148407949-148407971
Sequence TATCAAAGGGAGAATGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199491783_1199491787 1 Left 1199491783 X:148407949-148407971 CCATCTACATTCTCCCTTTGATA No data
Right 1199491787 X:148407973-148407995 GCTAGGCTGTACTAATCCTGTGG No data
1199491783_1199491791 29 Left 1199491783 X:148407949-148407971 CCATCTACATTCTCCCTTTGATA No data
Right 1199491791 X:148408001-148408023 CAGAAGAGCCAGGCTCTCTCTGG No data
1199491783_1199491789 19 Left 1199491783 X:148407949-148407971 CCATCTACATTCTCCCTTTGATA No data
Right 1199491789 X:148407991-148408013 TGTGGTTTTCCAGAAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199491783 Original CRISPR TATCAAAGGGAGAATGTAGA TGG (reversed) Intergenic
No off target data available for this crispr