ID: 1199491864

View in Genome Browser
Species Human (GRCh38)
Location X:148408815-148408837
Sequence CACCTAAGACTCCTTTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199491864_1199491867 7 Left 1199491864 X:148408815-148408837 CCTTCCTAAAGGAGTCTTAGGTG No data
Right 1199491867 X:148408845-148408867 TTCTGTCCTATATCAGGCACTGG No data
1199491864_1199491866 1 Left 1199491864 X:148408815-148408837 CCTTCCTAAAGGAGTCTTAGGTG No data
Right 1199491866 X:148408839-148408861 TGAGAGTTCTGTCCTATATCAGG No data
1199491864_1199491869 14 Left 1199491864 X:148408815-148408837 CCTTCCTAAAGGAGTCTTAGGTG No data
Right 1199491869 X:148408852-148408874 CTATATCAGGCACTGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199491864 Original CRISPR CACCTAAGACTCCTTTAGGA AGG (reversed) Intergenic
No off target data available for this crispr