ID: 1199493215

View in Genome Browser
Species Human (GRCh38)
Location X:148424113-148424135
Sequence GGTCTGAATAGAACAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199493215_1199493218 -10 Left 1199493215 X:148424113-148424135 CCACCTTTTGTTCTATTCAGACC No data
Right 1199493218 X:148424126-148424148 TATTCAGACCCTCAGTGGATTGG No data
1199493215_1199493221 12 Left 1199493215 X:148424113-148424135 CCACCTTTTGTTCTATTCAGACC No data
Right 1199493221 X:148424148-148424170 GATTATACCCACCCACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199493215 Original CRISPR GGTCTGAATAGAACAAAAGG TGG (reversed) Intergenic
No off target data available for this crispr