ID: 1199493218

View in Genome Browser
Species Human (GRCh38)
Location X:148424126-148424148
Sequence TATTCAGACCCTCAGTGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199493214_1199493218 -7 Left 1199493214 X:148424110-148424132 CCTCCACCTTTTGTTCTATTCAG No data
Right 1199493218 X:148424126-148424148 TATTCAGACCCTCAGTGGATTGG No data
1199493212_1199493218 0 Left 1199493212 X:148424103-148424125 CCTCCATCCTCCACCTTTTGTTC No data
Right 1199493218 X:148424126-148424148 TATTCAGACCCTCAGTGGATTGG No data
1199493213_1199493218 -3 Left 1199493213 X:148424106-148424128 CCATCCTCCACCTTTTGTTCTAT No data
Right 1199493218 X:148424126-148424148 TATTCAGACCCTCAGTGGATTGG No data
1199493215_1199493218 -10 Left 1199493215 X:148424113-148424135 CCACCTTTTGTTCTATTCAGACC No data
Right 1199493218 X:148424126-148424148 TATTCAGACCCTCAGTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199493218 Original CRISPR TATTCAGACCCTCAGTGGAT TGG Intergenic
No off target data available for this crispr