ID: 1199493221

View in Genome Browser
Species Human (GRCh38)
Location X:148424148-148424170
Sequence GATTATACCCACCCACACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199493219_1199493221 -9 Left 1199493219 X:148424134-148424156 CCCTCAGTGGATTGGATTATACC No data
Right 1199493221 X:148424148-148424170 GATTATACCCACCCACACTGAGG No data
1199493214_1199493221 15 Left 1199493214 X:148424110-148424132 CCTCCACCTTTTGTTCTATTCAG No data
Right 1199493221 X:148424148-148424170 GATTATACCCACCCACACTGAGG No data
1199493215_1199493221 12 Left 1199493215 X:148424113-148424135 CCACCTTTTGTTCTATTCAGACC No data
Right 1199493221 X:148424148-148424170 GATTATACCCACCCACACTGAGG No data
1199493220_1199493221 -10 Left 1199493220 X:148424135-148424157 CCTCAGTGGATTGGATTATACCC No data
Right 1199493221 X:148424148-148424170 GATTATACCCACCCACACTGAGG No data
1199493216_1199493221 9 Left 1199493216 X:148424116-148424138 CCTTTTGTTCTATTCAGACCCTC No data
Right 1199493221 X:148424148-148424170 GATTATACCCACCCACACTGAGG No data
1199493213_1199493221 19 Left 1199493213 X:148424106-148424128 CCATCCTCCACCTTTTGTTCTAT No data
Right 1199493221 X:148424148-148424170 GATTATACCCACCCACACTGAGG No data
1199493212_1199493221 22 Left 1199493212 X:148424103-148424125 CCTCCATCCTCCACCTTTTGTTC No data
Right 1199493221 X:148424148-148424170 GATTATACCCACCCACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199493221 Original CRISPR GATTATACCCACCCACACTG AGG Intergenic
No off target data available for this crispr