ID: 1199494974

View in Genome Browser
Species Human (GRCh38)
Location X:148442584-148442606
Sequence CAGGAAATGAACTTGGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199494970_1199494974 -9 Left 1199494970 X:148442570-148442592 CCCTCAAGTGGGTTCAGGAAATG No data
Right 1199494974 X:148442584-148442606 CAGGAAATGAACTTGGCTCAGGG No data
1199494966_1199494974 12 Left 1199494966 X:148442549-148442571 CCAGGGGTTGATGGGAAAGAACC No data
Right 1199494974 X:148442584-148442606 CAGGAAATGAACTTGGCTCAGGG No data
1199494971_1199494974 -10 Left 1199494971 X:148442571-148442593 CCTCAAGTGGGTTCAGGAAATGA No data
Right 1199494974 X:148442584-148442606 CAGGAAATGAACTTGGCTCAGGG No data
1199494963_1199494974 25 Left 1199494963 X:148442536-148442558 CCAGAACAAGGCTCCAGGGGTTG No data
Right 1199494974 X:148442584-148442606 CAGGAAATGAACTTGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199494974 Original CRISPR CAGGAAATGAACTTGGCTCA GGG Intergenic
No off target data available for this crispr