ID: 1199499593

View in Genome Browser
Species Human (GRCh38)
Location X:148495302-148495324
Sequence GCCCTAGATTTATAATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199499592_1199499593 -7 Left 1199499592 X:148495286-148495308 CCAAAGAGGTTTCTTAGCCCTAG No data
Right 1199499593 X:148495302-148495324 GCCCTAGATTTATAATCTCCAGG No data
1199499585_1199499593 21 Left 1199499585 X:148495258-148495280 CCACCAACATGTGTTCCCCAACA No data
Right 1199499593 X:148495302-148495324 GCCCTAGATTTATAATCTCCAGG No data
1199499584_1199499593 22 Left 1199499584 X:148495257-148495279 CCCACCAACATGTGTTCCCCAAC No data
Right 1199499593 X:148495302-148495324 GCCCTAGATTTATAATCTCCAGG No data
1199499590_1199499593 5 Left 1199499590 X:148495274-148495296 CCCAACAGTTGGCCAAAGAGGTT No data
Right 1199499593 X:148495302-148495324 GCCCTAGATTTATAATCTCCAGG No data
1199499589_1199499593 6 Left 1199499589 X:148495273-148495295 CCCCAACAGTTGGCCAAAGAGGT No data
Right 1199499593 X:148495302-148495324 GCCCTAGATTTATAATCTCCAGG No data
1199499583_1199499593 30 Left 1199499583 X:148495249-148495271 CCTTACAGCCCACCAACATGTGT No data
Right 1199499593 X:148495302-148495324 GCCCTAGATTTATAATCTCCAGG No data
1199499586_1199499593 18 Left 1199499586 X:148495261-148495283 CCAACATGTGTTCCCCAACAGTT No data
Right 1199499593 X:148495302-148495324 GCCCTAGATTTATAATCTCCAGG No data
1199499591_1199499593 4 Left 1199499591 X:148495275-148495297 CCAACAGTTGGCCAAAGAGGTTT No data
Right 1199499593 X:148495302-148495324 GCCCTAGATTTATAATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199499593 Original CRISPR GCCCTAGATTTATAATCTCC AGG Intergenic
No off target data available for this crispr