ID: 1199501295

View in Genome Browser
Species Human (GRCh38)
Location X:148509499-148509521
Sequence AAGTCTCCCAAGAAGAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199501293_1199501295 4 Left 1199501293 X:148509472-148509494 CCAACATTTGCTGAGGGACAACC 0: 1
1: 0
2: 0
3: 20
4: 172
Right 1199501295 X:148509499-148509521 AAGTCTCCCAAGAAGAGCTTTGG 0: 1
1: 0
2: 0
3: 17
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199501295 Original CRISPR AAGTCTCCCAAGAAGAGCTT TGG Intronic
904474621 1:30757009-30757031 AAGTTGCCCAACAAGAGCTTGGG + Intronic
907652036 1:56304348-56304370 AATTCCCCAAAGAACAGCTTAGG + Intergenic
909409331 1:75330938-75330960 AAGTTTTACAAGAAGAGTTTGGG - Intronic
909429626 1:75572211-75572233 AAGTCTCACAATGACAGCTTTGG + Intronic
911751559 1:101502287-101502309 AAGTCTCCCAATTACAGCTGAGG - Intergenic
913469672 1:119175705-119175727 AAGTCTCCCAAGTACAACTGAGG - Intergenic
917086276 1:171308258-171308280 AAGTCTCCCAATTACAGCTGAGG - Intergenic
917149530 1:171929460-171929482 AAGTCACCCAAACAGAGCATTGG + Intronic
917959985 1:180134430-180134452 AAGTTTCCCAAAAGGAGCTGGGG + Intergenic
918353953 1:183687546-183687568 AAATCTCCCAAAAAGATCTCAGG - Intronic
919699628 1:200618764-200618786 GAATGTCCAAAGAAGAGCTTAGG - Exonic
920008444 1:202850516-202850538 CAGTCTCCTAGGAACAGCTTTGG + Intergenic
920223854 1:204424070-204424092 AAGTCCCCCCAAAAGAGCATGGG + Exonic
924908057 1:248478160-248478182 AAATCTCCCAAGAAAAGCCTAGG - Intergenic
924916052 1:248569927-248569949 AAAACTCCCAAGAAAAGCCTAGG + Intergenic
1064349824 10:14566756-14566778 GAGAGTTCCAAGAAGAGCTTGGG + Intronic
1068879030 10:62029079-62029101 AAGTGTCCCACGAACAGTTTTGG - Intronic
1071300695 10:84253899-84253921 AAGGCACCACAGAAGAGCTTGGG - Intronic
1072525309 10:96266152-96266174 AATTCTCCCAAGAACAGATGGGG + Intronic
1079417037 11:20247934-20247956 GGGTGTCCCAAGGAGAGCTTGGG - Intergenic
1081439836 11:43067899-43067921 AAGCATACCAAGAATAGCTTAGG + Intergenic
1087085932 11:94219010-94219032 AAGTCACCCAATAAGACCTATGG - Intergenic
1087748143 11:101973101-101973123 AATTCTTCCAAGAACAGCTTTGG + Intronic
1087877226 11:103372869-103372891 AAGTCTTCAAAGAACAGCTCAGG - Intronic
1088112840 11:106281935-106281957 AGGTCTCCCAGGCAGAGCCTTGG + Intergenic
1089931461 11:122317654-122317676 AAGAATCCCAAGGAGACCTTAGG + Intergenic
1089991400 11:122864539-122864561 AAGTCTTCCCAGAGCAGCTTGGG - Intronic
1090160856 11:124493189-124493211 AGCTCTCTCAAGAAGAGTTTGGG - Intergenic
1092222020 12:6720637-6720659 AGGTGTCCCAAGAAGAGGATGGG - Intergenic
1092829955 12:12434010-12434032 AGGGTTCCCAAGATGAGCTTTGG + Intronic
1094569927 12:31632627-31632649 AACTTTGGCAAGAAGAGCTTTGG - Intergenic
1097803918 12:63944774-63944796 AAAGCTCCCTAGAACAGCTTTGG + Intronic
1099029248 12:77504712-77504734 AAGGCTGCCAGGAACAGCTTTGG + Intergenic
1103158870 12:118710754-118710776 AAGTGACCCAAGAAGAGGGTTGG - Intergenic
1106568672 13:30907503-30907525 CGGTCTGCCAAGAAGAGCTTGGG - Intronic
1107427655 13:40309849-40309871 AAATCTCCCAGAAAGAGGTTTGG + Intergenic
1107892040 13:44922391-44922413 CACTCTCCCAAGAACAGCTCTGG + Intergenic
1110213702 13:73003202-73003224 ATGATTCCCTAGAAGAGCTTTGG + Intronic
1112261163 13:97879755-97879777 GGGACTCCCAAGAAGAGATTAGG + Intergenic
1114282260 14:21204069-21204091 AACTCTCACAAGAACAGCATGGG + Intergenic
1114308508 14:21444938-21444960 GAGTCTACCAAGAAAAGCTATGG - Intronic
1115583869 14:34790285-34790307 CAGCCTCCCAAGTAGAGCTGGGG + Intronic
1119849940 14:77860095-77860117 AAGACTTCCTAGAAGAGCTGGGG - Intronic
1120070496 14:80097300-80097322 ATGGCTCCCAATAGGAGCTTAGG - Intergenic
1121060658 14:90906198-90906220 AAAGATCCCAAGAAGAGATTGGG - Exonic
1124453909 15:29822736-29822758 AAGTCTCTTAAGGAAAGCTTTGG - Intronic
1126086332 15:45013962-45013984 AAGTCTCCCAATTACAGCTGAGG - Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1128261138 15:66233839-66233861 CACTCTCCCCAGAAGACCTTTGG - Intronic
1130527697 15:84721473-84721495 AAGTCTCCCTGGAAGATTTTTGG + Intergenic
1132742111 16:1419912-1419934 AAGTGTCACCAGAAGTGCTTTGG + Exonic
1136081430 16:27854779-27854801 AAGTTCCCCAAGATGAGCGTGGG + Intronic
1136627583 16:31471750-31471772 AAGTCTCCCAGGAATGGCATGGG + Intronic
1138230963 16:55335906-55335928 AAATCTCTCATGAACAGCTTGGG - Intergenic
1140696309 16:77537721-77537743 AAGTTTTGCAAGAAGAGCTGAGG - Intergenic
1142170897 16:88622288-88622310 AAGTCTCCCAAGAAGAAACTCGG + Exonic
1142182125 16:88676429-88676451 CCGGCTCCCCAGAAGAGCTTGGG - Intergenic
1142187944 16:88703377-88703399 AAGGGTCCCAGGCAGAGCTTGGG + Intronic
1142737375 17:1909726-1909748 ATGTCTCCTAAAAAGAGCTGAGG - Intergenic
1143726396 17:8849781-8849803 AAGGCTCCCATGGAGAGCTCAGG - Exonic
1147004247 17:37389164-37389186 AAGTTGCCCAACAAGAGGTTTGG + Intronic
1148765485 17:50036262-50036284 AGCTTTCCCAAGGAGAGCTTGGG - Intergenic
1150999788 17:70361758-70361780 AAGTGTCCCAATAACAGCATAGG - Intergenic
1154504891 18:15026852-15026874 AAGTCAGCCAAGAAGTGTTTAGG - Intergenic
1156838495 18:41583991-41584013 GATGCTCCCAGGAAGAGCTTTGG + Intergenic
1158445231 18:57514212-57514234 CACTGTCACAAGAAGAGCTTGGG + Intergenic
1160121680 18:76135912-76135934 AAATCTCCCATGAAGGGTTTTGG + Intergenic
1161492367 19:4569049-4569071 AAGTCCCAGAAGAAGAGCTTTGG + Intergenic
1162617215 19:11811769-11811791 CAGCCTCCCAAGTAGAGCCTGGG - Intergenic
926047117 2:9717889-9717911 CAGTCTCCCCAGAGGAGCTGGGG - Intergenic
928621391 2:33091812-33091834 AAGTTTCCCTGGAAGAGCTCAGG - Intronic
931153242 2:59598474-59598496 CAGTCTCACAAGAACAGCATGGG + Intergenic
931521530 2:63102811-63102833 AAGTCTCCAAAGAAAAGCCCAGG - Intergenic
932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG + Intronic
933818439 2:86088061-86088083 ATTTTTCCCAAGCAGAGCTTGGG + Intronic
935976011 2:108579873-108579895 AATCATCCCAAGAAGAGTTTAGG + Intronic
938504086 2:131857048-131857070 AAGTCAGCCAAGAAGTGTTTAGG - Intergenic
942482066 2:176399220-176399242 AAATCTCCTTAGAAGAGCTCTGG + Intergenic
943727143 2:191263637-191263659 AATTTTCCCAAGAAAAGTTTTGG - Intronic
947394896 2:229676680-229676702 ATGTCTCCCAAGGAGAACTCTGG + Intronic
1170048798 20:12116541-12116563 AGTTCTCCCCAGCAGAGCTTGGG + Intergenic
1171446554 20:25208107-25208129 AGGTCAGCCAAGAAGAGCATGGG - Intronic
1171461491 20:25300577-25300599 AAGTCTCCCAACAAGATCTCAGG + Intronic
1172642550 20:36449501-36449523 AGGTCTCCAAACAAGAGCTGAGG + Intronic
1174980430 20:55388217-55388239 AATTATCCCAAGAAGAGTTTCGG - Intergenic
1176613273 21:9006353-9006375 AAGACTTACAAGCAGAGCTTGGG + Intergenic
1177534032 21:22401332-22401354 ATTTCTCCCAAGAAGAGAATAGG + Intergenic
1177732341 21:25043817-25043839 TGTTCTCCCAAGAAGAGATTTGG - Intergenic
1177992351 21:28053115-28053137 AAGTCAGCCAAGAAGTGTTTAGG + Intergenic
1179894055 21:44351558-44351580 AAGTCACCTGAGAACAGCTTGGG - Intronic
1181710673 22:24685856-24685878 CAGCCGCCCAAGAGGAGCTTGGG + Intergenic
1182004989 22:26952512-26952534 AATTCCCCCAAGAAGCACTTTGG - Intergenic
1182313900 22:29429904-29429926 AGGTCACCCAAGGAGAGCTCAGG + Intergenic
951009240 3:17657225-17657247 AAATCTCCCAACAAAAGCTGGGG + Intronic
952453178 3:33450030-33450052 AAGTCTCCCAATTACAGCTGAGG - Intergenic
952742985 3:36752097-36752119 AAGTCTCCCAAGAGTTACTTTGG + Intergenic
953099121 3:39808926-39808948 AAGTCTCCCAAACACAGCTGCGG - Intronic
953749592 3:45599095-45599117 CAGTCTCCCAAGCAGAGATTTGG + Intronic
956105315 3:65811394-65811416 AAGCTTCCCAAGAAGAGGGTTGG - Intronic
959023883 3:101218786-101218808 GAGTCTCTCAAGAACAGCCTGGG + Intergenic
959938562 3:112056553-112056575 AGGTCTTCCAAGAAGATCTAGGG + Intronic
960468796 3:118033676-118033698 AAGTCTCCCCAGAAATGATTTGG + Intergenic
961025611 3:123553453-123553475 AAGATTCCCAAGAAGGGCTGTGG - Intronic
962023087 3:131520415-131520437 AAGACTCCTAAGAAGATGTTAGG + Intergenic
963073911 3:141328913-141328935 AATGCTCCCAAAGAGAGCTTGGG - Intronic
963287332 3:143445911-143445933 AAGACTAACAAGAACAGCTTTGG + Intronic
964812165 3:160677387-160677409 AAGTCCCAAAAGAAGAACTTGGG - Exonic
965139340 3:164814877-164814899 AAGTCTCCCAATTACAGCTGAGG - Intergenic
968607793 4:1543696-1543718 ACTTCCCCCAAGAAGAGCTGAGG + Intergenic
968849843 4:3071756-3071778 ATGTCTTACAAGAAGAGATTAGG + Intergenic
970589486 4:17546787-17546809 AGATCTCTCAAGAATAGCTTGGG + Intergenic
971444177 4:26724766-26724788 AACTTACCCAAGAAGACCTTAGG - Intronic
972966707 4:44519291-44519313 AAGTCTTCCAGGAAGAGTTGAGG + Intergenic
983523549 4:168736494-168736516 AAGTCTCCCAGAAAGGACTTCGG - Intronic
984313409 4:178093341-178093363 AATTCTGTCAAGAAGTGCTTTGG - Intergenic
984531846 4:180925418-180925440 AAGGCTCCCAAGCTGAGCTTGGG - Intergenic
988357932 5:30201001-30201023 AAGTCTCCCAATTACAGCTGAGG - Intergenic
989315234 5:40070729-40070751 AAGGCTCAGAAGAAGAGCTGTGG + Intergenic
989716507 5:44468917-44468939 AAGTCTCCCACAAACAGATTAGG - Intergenic
989964237 5:50450197-50450219 AAGTCTCCCAATTAGAACTGAGG + Intergenic
990574045 5:57107642-57107664 AAGTCTTCCATGAAGAACTAAGG + Intergenic
993510402 5:88764291-88764313 AAGTCTTCCATGAAGAGATTAGG + Intronic
994981996 5:106887336-106887358 AAGTTTCCAAAGAACAGTTTAGG + Intergenic
995197008 5:109382020-109382042 AGATCTCCCATAAAGAGCTTTGG - Intronic
995414597 5:111895004-111895026 AAGTTTCCAGAGAATAGCTTTGG + Intronic
995725493 5:115177749-115177771 GTCTCTCCCAAGAAGAACTTAGG - Intronic
997579773 5:135010003-135010025 AAGCCTCCCATGCTGAGCTTTGG + Intronic
997618224 5:135267327-135267349 AAGTTTCCCAGGCAGAGCTTGGG + Intronic
998143499 5:139712492-139712514 AAGTTTCCCCAGAAGGGCTTGGG + Intergenic
998152742 5:139766304-139766326 AAGTATCCCATGAAAGGCTTAGG - Intergenic
1001746440 5:174096304-174096326 AAGTCTCCCCAGAAGTCCTCAGG - Intronic
1002903217 6:1427167-1427189 AAGTCCCTGAAGAAGACCTTGGG + Intergenic
1003236618 6:4300808-4300830 AACCCTCCCAAGAAGGGCTTTGG - Intergenic
1003618021 6:7672960-7672982 TAGTCACCGTAGAAGAGCTTGGG + Intergenic
1005282618 6:24290292-24290314 GAGTCACTCAAGAAGAGCTCTGG - Intronic
1009278518 6:61717050-61717072 AAGTCTCTCAAGAAAACCTAAGG - Intronic
1009505803 6:64476456-64476478 AACTCTCCCCAGAAGATCTCTGG + Intronic
1010485641 6:76409954-76409976 AAGTTTTCAAAGAAGAGCTCAGG - Intergenic
1011986337 6:93451351-93451373 AAGTCTCCCAGCAAGGGCCTGGG + Intergenic
1012544831 6:100406418-100406440 GACACTCCCAAGAACAGCTTGGG - Intronic
1012750742 6:103160378-103160400 ATGGCTGCCAAGGAGAGCTTGGG - Intergenic
1014815856 6:125934752-125934774 AAGTATCCTAGAAAGAGCTTGGG + Intergenic
1017835438 6:158173327-158173349 AAGTCTTCCAAAAAGATTTTGGG + Intronic
1018647105 6:165959123-165959145 AAGTTTGCCAAGAACAGCCTGGG - Intronic
1020747364 7:12094370-12094392 AAGTCAACAAAGAAGAGCTATGG + Intergenic
1021406624 7:20275432-20275454 CTGTCTCCCAAGAAGTACTTTGG + Intergenic
1024015314 7:45308299-45308321 AAGTGGCCCAAGTACAGCTTGGG + Intergenic
1024408595 7:49012314-49012336 AAGTCTCCCAAATAGATTTTAGG - Intergenic
1025715703 7:63953495-63953517 ATGTCTCCCCAGGAGAGCTGGGG + Intergenic
1026865020 7:73818387-73818409 AAGTCTCCCTAGAGGAGGTGAGG + Intronic
1027434931 7:78154733-78154755 GAGGTTCCCAAGAAGGGCTTTGG - Intronic
1027791250 7:82640483-82640505 AAGTCTCCCAATTACAGCTGAGG - Intergenic
1028336527 7:89664007-89664029 AGGTCTCTCAAGAAGATTTTAGG - Intergenic
1028625559 7:92872936-92872958 AAGGCTCCCAGGAAGTGGTTAGG + Intergenic
1029333772 7:99882526-99882548 AGGCCTCCCAAGAAGATCATCGG + Intronic
1031002647 7:116435084-116435106 AAGTGTCCCAAGATGTGGTTGGG + Intronic
1034213150 7:149382662-149382684 GATTCTCCCAAGAGAAGCTTAGG + Intergenic
1034637873 7:152581615-152581637 AAGTCCCCCAAAAAGTGCCTAGG + Intergenic
1036222417 8:6931827-6931849 AGGTGTCCCAAGAGCAGCTTGGG + Intergenic
1036507331 8:9367502-9367524 AATACTCCCCAGAAGAGCTTCGG + Intergenic
1037143367 8:15543855-15543877 AAATTTCCCAGGAAGAGATTTGG + Intronic
1039525876 8:38215890-38215912 AAATTTCCTAAGAATAGCTTTGG + Intergenic
1040839753 8:51772459-51772481 AGGTCTGCCTAGACGAGCTTAGG - Intronic
1041109661 8:54472572-54472594 CTGTCTCCCCAGAAGAACTTTGG + Intergenic
1042705364 8:71661103-71661125 ATGTCTACCATGAAGAGCGTGGG - Intergenic
1043230847 8:77799214-77799236 AAGTGTACCAGGAAAAGCTTTGG - Intergenic
1044445422 8:92269861-92269883 GACTATCCCAAGAACAGCTTGGG + Intergenic
1044738221 8:95300744-95300766 AAGTCTGCCAAAGAGAGCTTAGG - Intergenic
1047671544 8:127152843-127152865 AAGTCACACAAGAAGAACTGTGG + Intergenic
1048482319 8:134810043-134810065 AAGTCTCTAAAGCAGAGTTTAGG - Intergenic
1050721713 9:8599075-8599097 AAGTCTCATGAGAACAGCTTGGG - Intronic
1053031768 9:34786337-34786359 CAGTCTCCTGAGAAGAGCTAAGG + Intergenic
1055359265 9:75471862-75471884 AATTAGCACAAGAAGAGCTTTGG - Intergenic
1056698195 9:88878582-88878604 AAGTGTCCCCAGAAGAGCCCAGG - Intergenic
1186439624 X:9574536-9574558 AAGTCTCCCCAGCAAAGGTTCGG - Intronic
1190533157 X:51400434-51400456 CAGTCTCCCAGGAAGGGCTCAGG - Intergenic
1193438974 X:81515519-81515541 AAGTGGCCAAAGTAGAGCTTGGG + Intergenic
1194084610 X:89510244-89510266 AAGGCACCCAAGTAGAGCTCAGG - Intergenic
1194374010 X:93110290-93110312 AAGTGTCCCAGGTACAGCTTTGG - Intergenic
1199219365 X:145299167-145299189 CAGTGTCCCAATAAGATCTTAGG - Intergenic
1199492999 X:148421983-148422005 AAGTCTTCAGAGAAGAGCTGAGG - Intergenic
1199501295 X:148509499-148509521 AAGTCTCCCAAGAAGAGCTTTGG + Intronic
1199846954 X:151698583-151698605 AGGTCTCTGGAGAAGAGCTTGGG + Exonic
1200682039 Y:6224361-6224383 AAGTGTCCCAGGTACAGCTTTGG - Intergenic
1201473067 Y:14354539-14354561 AAGTCTCCCAATTACAGCTGAGG + Intergenic