ID: 1199502631

View in Genome Browser
Species Human (GRCh38)
Location X:148524912-148524934
Sequence GTTCCTTTAGAACACTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199502631_1199502633 21 Left 1199502631 X:148524912-148524934 CCTTTTAAGTGTTCTAAAGGAAC 0: 1
1: 0
2: 0
3: 16
4: 143
Right 1199502633 X:148524956-148524978 GTTGAATTTTCTAATATTTTTGG 0: 1
1: 0
2: 9
3: 81
4: 834
1199502631_1199502632 -5 Left 1199502631 X:148524912-148524934 CCTTTTAAGTGTTCTAAAGGAAC 0: 1
1: 0
2: 0
3: 16
4: 143
Right 1199502632 X:148524930-148524952 GGAACAAGTTTTGAGAAATTAGG 0: 1
1: 0
2: 4
3: 22
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199502631 Original CRISPR GTTCCTTTAGAACACTTAAA AGG (reversed) Intronic
906447449 1:45914909-45914931 GTAGCTTAAGAAAACTTAAATGG + Intronic
907935991 1:59042704-59042726 TTCCCTTTAGAAGACTTGAATGG - Intergenic
908277178 1:62485802-62485824 TTTCCTTTGTAAAACTTAAATGG - Intronic
909983949 1:82137367-82137389 GTTCCCCTAGACCACTTATAAGG + Intergenic
911125311 1:94335955-94335977 ATTCCTTTTGAAAACCTAAATGG - Intergenic
917158721 1:172032960-172032982 GTTCCTTTATAAAACTCAATGGG - Intronic
919530593 1:198714477-198714499 GTCCACATAGAACACTTAAACGG + Intronic
920610175 1:207428287-207428309 CTTCCCTTAGTGCACTTAAATGG + Intergenic
922168333 1:223134297-223134319 TTCCCTTTAGAACACTGAAGGGG + Intronic
1080271681 11:30457183-30457205 GTTCCTTTAGAACATGTCCAGGG - Intronic
1082105748 11:48219515-48219537 GTTCCTTTTGAACACTTTCATGG + Intergenic
1087162281 11:94960351-94960373 TTACCTTTAGAAGACTTAAAAGG - Intergenic
1090160262 11:124485430-124485452 TTTCCTTTAGAAGATTTAGAGGG + Intergenic
1090618922 11:128543695-128543717 GTTCCTTAAGTTCCCTTAAAAGG + Intronic
1093819426 12:23595193-23595215 GGTGCTATAGAACACTAAAAAGG + Intronic
1095802021 12:46279388-46279410 GTTCCTTTTCATCACTGAAAAGG - Intergenic
1097551318 12:61075415-61075437 GTTCCTTTAAAACATTTTAGTGG + Intergenic
1097726139 12:63077789-63077811 GTTCCTCTAGATCACTTAATAGG - Intergenic
1100868001 12:98878269-98878291 TGTCCTTTTGAACACTTAAAAGG + Intronic
1101179550 12:102199541-102199563 GTTCCGTAAGAACACTTGACAGG + Intergenic
1101544545 12:105699308-105699330 GTTGCTTTAGAAAATTTATACGG + Intergenic
1106802201 13:33267745-33267767 GTTAGATTAGAAGACTTAAAAGG + Intronic
1108353038 13:49604622-49604644 CTTCCTCTAGAACACTCAACTGG + Intergenic
1110079629 13:71293943-71293965 GTACCTTGAGACCACTTAAAAGG - Intergenic
1110409334 13:75186674-75186696 CTTCCTCTAGAACACTTAACTGG - Intergenic
1111038476 13:82711067-82711089 ATACCTTTAGACCACTCAAAAGG - Intergenic
1112768145 13:102767966-102767988 TTTTCTAAAGAACACTTAAAAGG + Intronic
1114684461 14:24514923-24514945 GTGCCTTTAGCAAACTTACAAGG + Intergenic
1115128644 14:30026355-30026377 ATCCTTTTAGAACACTTAAGAGG - Intronic
1118198866 14:63653510-63653532 GTTCATTTTCAACAATTAAAGGG - Intergenic
1121382615 14:93486732-93486754 GCTACTTTTGAATACTTAAAGGG + Intronic
1121891030 14:97590744-97590766 CTTTCTTTAGAAGACTTAGAAGG - Intergenic
1123878607 15:24651922-24651944 GTTCCTTTATAATTCTAAAAGGG - Intergenic
1124526980 15:30463917-30463939 GTTGCTTTATATCTCTTAAATGG + Intergenic
1124610654 15:31205913-31205935 TTTCCTATACAACACATAAAAGG - Intergenic
1124613847 15:31227526-31227548 GTTCCTTCAGCTCACTTGAAAGG - Intergenic
1124771673 15:32543766-32543788 GTTGCTTTATATCTCTTAAATGG - Intergenic
1126574929 15:50187062-50187084 GTTTCTTTATAACACTTAACAGG + Intronic
1126834950 15:52652615-52652637 GTTTCTTTAGTCCTCTTAAAAGG - Intronic
1127768982 15:62215318-62215340 GTTTCTTTTGAACAGTTAATGGG - Intergenic
1131774274 15:95776977-95776999 GCCCCTTTTGAAAACTTAAAAGG + Intergenic
1133545365 16:6801281-6801303 TGTCCTTTAGAACATATAAATGG + Intronic
1137865364 16:51890066-51890088 ATTACTATAGAACACTTAGAAGG + Intergenic
1137975131 16:53024772-53024794 GTGCCTTTAGGACATTCAAATGG + Intergenic
1140562363 16:75998115-75998137 CTTCCTTTATAGCACTTAGAAGG - Intergenic
1140562496 16:75999529-75999551 TCTCCTTAAGAACACTTAACAGG - Intergenic
1140824383 16:78692296-78692318 ATTCCTTTTGAACATTTGAAAGG + Intronic
1142327456 16:89425402-89425424 GTAACTTTAGAGGACTTAAAGGG + Intronic
1146437591 17:32865550-32865572 GTTCTTTTAGAACTCTGAACTGG + Intronic
1146978516 17:37137414-37137436 TTTCCTTTAGAACACATGAAAGG + Intronic
1148726146 17:49791701-49791723 CTTTATTTAGAACACTTAAATGG - Intronic
1151342825 17:73482633-73482655 GTTCATTGAGAGCACTTAATTGG - Intronic
1157763074 18:50279002-50279024 TTTCCTGTACAACACTTAACAGG + Intronic
1158975851 18:62711150-62711172 GTACATTTGGAACACTTTAAAGG + Intergenic
1160248568 18:77181056-77181078 GTCACTTAAGAACACTCAAAAGG + Intergenic
1162097672 19:8320768-8320790 GTTCCTTTAGACCCCTGAAACGG - Intronic
1162649572 19:12077083-12077105 GTTCCTTTCGTAGACATAAAAGG + Exonic
1162672851 19:12272431-12272453 GTTCCTTTAATAGACATAAAAGG - Exonic
1168030653 19:53677144-53677166 GGTCCTTTAGAACCCTAGAAGGG + Intergenic
926743576 2:16131943-16131965 GTATATATAGAACACTTAAATGG - Intergenic
928053898 2:28030882-28030904 GTTTCTTTAGTACCCTGAAACGG - Intronic
929360801 2:41087957-41087979 GTTCCTTTCAAACAGTTACAGGG - Intergenic
929654163 2:43713476-43713498 ATTCTTTTACAACATTTAAAAGG - Intronic
930992765 2:57679706-57679728 GTTCATGTTGAAAACTTAAAAGG - Intergenic
933142957 2:78816431-78816453 TTTCCTCTGGAACATTTAAAGGG + Intergenic
935846819 2:107174917-107174939 ATCTCTTTAGAACACTTCAAGGG - Intergenic
939843422 2:147215834-147215856 GTTCCCTTAGACTCCTTAAAAGG + Intergenic
941926503 2:170900924-170900946 GTTCCTTTAAAAGATTAAAAAGG - Intergenic
943089891 2:183361475-183361497 GTTCCTTTAATATTCTTAAAAGG - Intergenic
943716277 2:191155530-191155552 GTTTCCTCAGAACACTTAAGAGG - Intergenic
944440518 2:199738863-199738885 GTTCCTTTGGAAGAGTTAAGTGG - Intergenic
946086568 2:217179394-217179416 CTTCCTTTAGAAGCCTGAAATGG + Intergenic
947616984 2:231564321-231564343 GTTTCTTTATAATACTGAAAAGG + Intergenic
1171377765 20:24705324-24705346 GCTTCATTAGAACATTTAAAAGG + Intergenic
1173246983 20:41343713-41343735 GTTCCTTTCAAACACATGAAAGG + Intronic
1176724451 21:10418984-10419006 GTGCCTTTAAGACACTTAATGGG + Intergenic
1177416858 21:20805011-20805033 GTTCCTTCAAAACACTCAAGTGG + Intergenic
1179124407 21:38578288-38578310 GTGCCTCTAGAGCACTTACAGGG - Intronic
1179548666 21:42128969-42128991 CTTCCTTTAGAACTCTCAGAGGG - Intronic
950097756 3:10339732-10339754 GATCCTTTAGAGCACTCAGAGGG - Intronic
950332670 3:12168928-12168950 TTTCCTTTACAACAGGTAAAAGG - Intronic
950618616 3:14183465-14183487 GTGCCTTTAGAAGACTGCAATGG + Intronic
951092758 3:18594240-18594262 TTCCCTTTAGAATACTAAAAGGG - Intergenic
951535344 3:23735666-23735688 ATTCCTAGAAAACACTTAAAAGG + Intergenic
951915678 3:27798399-27798421 GTTCTGTTGGAAAACTTAAAAGG - Intergenic
952045954 3:29320338-29320360 ATTCCTTTAGAGCATTTAAAAGG - Intronic
953048283 3:39315599-39315621 GTTCTTTGAGAACACCAAAATGG - Intergenic
953249619 3:41232633-41232655 CATCCTTTAGGACCCTTAAATGG - Intronic
957225897 3:77445762-77445784 GTTGCTTTTAAACAATTAAAAGG + Intronic
957793968 3:84978585-84978607 GTTCATTTAAAACAATAAAAGGG + Intronic
957838405 3:85632007-85632029 TTTCCTCTACAATACTTAAATGG + Intronic
962091382 3:132247460-132247482 GTGCCTTTAAAACACTTGTAGGG - Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964405638 3:156345956-156345978 GTTTCTTTAGAACAATGAGATGG - Intronic
964504446 3:157383328-157383350 GCTCCTTTAGAAGACTTGACTGG - Intronic
965628986 3:170711247-170711269 GTCCCTTTGGAACAATAAAAGGG + Intronic
967932332 3:194699307-194699329 GATCATTTAGAACATTTTAATGG + Intergenic
970068314 4:12124908-12124930 ATGTCTTAAGAACACTTAAATGG - Intergenic
971354261 4:25880117-25880139 GTTCATTTAAAAAAATTAAATGG - Intronic
977540622 4:98314061-98314083 GCTCCTTTAGTACAATGAAAAGG - Intronic
977982337 4:103339120-103339142 GTTCCTTTAGTATTCTAAAATGG + Intergenic
979809512 4:125018261-125018283 GTTTCCATAGAACACTTAACTGG + Intergenic
984124409 4:175788775-175788797 GTTCATTAAGAACTATTAAAGGG - Intronic
985176132 4:187203813-187203835 GTTGTTTCAGAACACATAAAAGG + Intergenic
987063871 5:14268937-14268959 GTTCCTTCAAAACTCTTGAATGG - Intronic
987901563 5:24018628-24018650 ATTGCTTGAGAACACTGAAATGG - Intronic
990671554 5:58135960-58135982 GTGCCTTTAGAAAGGTTAAATGG - Intergenic
991212325 5:64120117-64120139 ATTTGTTCAGAACACTTAAATGG + Intergenic
991323454 5:65402723-65402745 TGTCCTTAAGAAGACTTAAAGGG - Intronic
992214297 5:74510280-74510302 GTTCAATTACAACACTTTAATGG + Intergenic
993330403 5:86593157-86593179 GTAACTTTATAACACTTACATGG + Intergenic
994068160 5:95566795-95566817 GTTGCCTTGGAACACATAAATGG + Intronic
995953269 5:117742973-117742995 GTTCTTTTATACCATTTAAAGGG - Intergenic
997786532 5:136718783-136718805 GGTCCTTTAGAAAAGTCAAATGG + Intergenic
998581275 5:143378544-143378566 GTTCTTTGAGAACACTTACCTGG + Intronic
998867248 5:146517828-146517850 GTTCCTATAGAACAGTAAATTGG + Intergenic
1000257008 5:159549068-159549090 TTTCATTTAGAGCTCTTAAATGG + Intergenic
1000485082 5:161831252-161831274 GTTCATTTAGAACCCTTTACAGG + Intergenic
1000651879 5:163828759-163828781 GTACCTGAAGAACACTGAAAAGG - Intergenic
1001211447 5:169813612-169813634 GTCCCTTGAGAACCCTTAAAGGG - Intronic
1003855155 6:10266145-10266167 GCTCCTTGAGAATACTTAAAAGG - Intergenic
1005056853 6:21737347-21737369 GTTCCTTTACTAGACTGAAAGGG + Intergenic
1005252301 6:23961464-23961486 GCTCCTATAGTTCACTTAAATGG + Intergenic
1011110266 6:83829793-83829815 GTCCTTTTAGAACACAGAAAAGG - Intergenic
1011752655 6:90468797-90468819 GTTCCTCTAGTCCACTTATAAGG - Intergenic
1012957705 6:105589082-105589104 GATCCTTTTGAACCCTTATATGG + Intergenic
1015042213 6:128735196-128735218 GTTGTTCTAAAACACTTAAATGG + Intergenic
1016161722 6:140889886-140889908 GTTCATTTAGCACGTTTAAAAGG + Intergenic
1017074626 6:150606414-150606436 GGTCCTTTGGAACAGTGAAATGG + Intronic
1018046919 6:159973548-159973570 GTTCCTTTGGAAAAATTACAGGG - Intronic
1019456749 7:1131842-1131864 TTTCCCTTAGAACTATTAAAAGG - Intronic
1027612979 7:80385598-80385620 ATTACTGTAGAACATTTAAAAGG - Intronic
1027748865 7:82115620-82115642 GTACTTTTAAAACACTTAAAAGG + Intronic
1027823136 7:83074551-83074573 GTTCCTTTAAAAGATTTTAATGG - Intronic
1031403551 7:121355212-121355234 TTTACTTTAGAGCACTTACATGG - Intronic
1037079736 8:14769486-14769508 GGTCTTTTAAAACACTTCAATGG + Intronic
1041519412 8:58739215-58739237 GTGCCTGTAGAACACAGAAAAGG + Intergenic
1043055514 8:75432837-75432859 GTTCTTTTGGAACACTTTATGGG + Intronic
1043294004 8:78641556-78641578 GTTTCAATAGATCACTTAAAAGG - Intergenic
1043517777 8:81011969-81011991 GTTTCTTTAGATCACTTTATCGG + Intronic
1043663863 8:82783244-82783266 GGTCCTTTAAAATACATAAAAGG + Intergenic
1045612813 8:103867484-103867506 TTTGCCTTAGAAAACTTAAAAGG - Intronic
1048318719 8:133381887-133381909 ATTCCTTAGGAACACTTTAATGG + Intergenic
1051711172 9:19932914-19932936 GTTCCTTTGAAGGACTTAAAAGG - Intergenic
1052616078 9:30843630-30843652 GTTCTCTTAGAACTCTTATAGGG + Intergenic
1054855479 9:69894646-69894668 GTTCACTTTGAACACTTACATGG - Intronic
1056934965 9:90909476-90909498 GTTACTTTTGAACACTTTAACGG + Intergenic
1057520446 9:95755586-95755608 GTTCCTTTAGGACAGGTAAATGG - Intergenic
1058421721 9:104838941-104838963 GTTGCTTTACAAGCCTTAAAAGG - Intronic
1058773395 9:108260989-108261011 GGTCCTTTATAACACGTACATGG + Intergenic
1059032588 9:110715117-110715139 GTTCCTTTAGCGGACTTCAAAGG - Intronic
1061107655 9:128544047-128544069 GCTCCATTAGAACCCCTAAATGG - Intergenic
1185935758 X:4256125-4256147 GTTCCTTTTGAAAGCTTGAAGGG + Intergenic
1186196825 X:7117265-7117287 CTTCCTAGAGAACAGTTAAATGG + Intronic
1189943168 X:46148935-46148957 TAACCTTTAGAAAACTTAAAAGG - Intergenic
1189961419 X:46328019-46328041 GCTTCTTTACAACACTTCAAAGG - Intergenic
1194679815 X:96838640-96838662 ATTCCTTTAGAACACCCACAAGG - Intronic
1196411118 X:115419895-115419917 AATCCATTCGAACACTTAAAGGG + Intergenic
1198322019 X:135527718-135527740 CTCCCTTTAGCTCACTTAAAAGG - Intronic
1199502631 X:148524912-148524934 GTTCCTTTAGAACACTTAAAAGG - Intronic