ID: 1199514037

View in Genome Browser
Species Human (GRCh38)
Location X:148655694-148655716
Sequence CTCCCAGGGAACCCTGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199514037_1199514041 27 Left 1199514037 X:148655694-148655716 CCACATTCAGGGTTCCCTGGGAG 0: 1
1: 0
2: 2
3: 23
4: 208
Right 1199514041 X:148655744-148655766 ACTGATGTTGCACCTCCATAAGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199514037 Original CRISPR CTCCCAGGGAACCCTGAATG TGG (reversed) Intronic
900559150 1:3295103-3295125 CTCCCAGGGCACCCAGGTTGTGG + Intronic
900592737 1:3467253-3467275 CCCCGAGGGAACCCAGAAGGTGG + Exonic
900638962 1:3679171-3679193 TTCCCACTGAACCCTGAATGAGG - Intronic
901394845 1:8973607-8973629 CCCCCAGGGAACCCGAATTGTGG + Intronic
902329675 1:15725192-15725214 CTCCCAGGGAAACCTGACAGGGG - Intronic
902597981 1:17522082-17522104 CTCCAAGGAAACCCTGACAGTGG - Intergenic
903213649 1:21831684-21831706 CACCCAGGGCTCCCTGATTGTGG - Exonic
905979552 1:42211278-42211300 CTCTCATGGAAGCCTGAATCTGG - Intronic
906060934 1:42948167-42948189 CTCCCAGGAAGCCATGGATGAGG + Intronic
906296345 1:44651265-44651287 CTCCCAGCCAACCCTGAAGGAGG - Exonic
906459655 1:46027631-46027653 CCCCCATGGAAGCCTGAGTGGGG + Intronic
907400172 1:54220364-54220386 CTCCCAACCCACCCTGAATGAGG + Intronic
908753043 1:67443047-67443069 CTTGCAGGGAAACCTGAAAGAGG + Intergenic
913690314 1:121273545-121273567 ATCCCAGGGAAGCAGGAATGGGG + Intronic
914147228 1:145006414-145006436 ATCCCAGGGAAGCAGGAATGGGG - Intronic
915680000 1:157572223-157572245 CCTCCAGGGATTCCTGAATGTGG - Intergenic
916764221 1:167844883-167844905 CTCCCTGGCCACCATGAATGGGG + Intronic
917498635 1:175565534-175565556 CTCCCAGGATCCCCTGAGTGAGG + Intronic
919531833 1:198730703-198730725 ACCCCATGAAACCCTGAATGTGG + Intronic
919800269 1:201349857-201349879 CTCCCAGGGAAGGCTGAGTGGGG + Intergenic
920477634 1:206292033-206292055 ATCCCAGGGAAGCAGGAATGGGG + Intronic
924273884 1:242365203-242365225 CTCTCAGGACACCCTGTATGAGG + Intronic
1063330582 10:5155150-5155172 CTCCTAGGGAAGCCTTAATGTGG - Intergenic
1064009040 10:11720674-11720696 CTCCCAGGGAACTTCGCATGAGG - Intergenic
1065078219 10:22102087-22102109 GTCTCAGGAAATCCTGAATGAGG - Intergenic
1066048947 10:31618126-31618148 TTCCCAGAGAAACCTGAGTGGGG - Intergenic
1066623504 10:37382376-37382398 CTCCCAGGGACCCCAGAGTGGGG + Intronic
1066710829 10:38231473-38231495 CTCTCAGGACACCCTGTATGAGG - Intergenic
1067726065 10:48772089-48772111 CTCCCAGGGAACCCGACCTGAGG - Intronic
1068401548 10:56534161-56534183 CTCCCAGGTGGCCCTGACTGGGG + Intergenic
1068812009 10:61266581-61266603 CTCCCAGGAAACTGGGAATGGGG + Intergenic
1069121849 10:64577227-64577249 CTCTCAGGAGACCCGGAATGGGG - Intergenic
1070785226 10:79158715-79158737 CTCCCAGGGATCCCTGGAGGTGG + Intronic
1070819044 10:79344078-79344100 CTCCCAGGTAGCCCTGTGTGTGG - Intergenic
1071430653 10:85603817-85603839 CTCCCAGGCCACCCTGCAGGTGG + Intronic
1073021960 10:100452506-100452528 CTTCCAGGGAACTATCAATGTGG + Intergenic
1073539363 10:104305871-104305893 CCCCCAGGGAACCCTGAGTAGGG + Intergenic
1074528458 10:114280597-114280619 TTCCCAGGGAAGCCTAAATCAGG + Intronic
1074840563 10:117346746-117346768 CTGCCAGGAAACCCTAAAAGTGG - Intronic
1075183308 10:120231997-120232019 CTTCTGGGGAACCCTAAATGAGG - Intergenic
1075322356 10:121502044-121502066 CACCCGGGGTACCCTGAGTGTGG - Intronic
1075953095 10:126498804-126498826 CACTCAGGGAACTCTGAATCTGG - Intronic
1076049411 10:127320784-127320806 CCCCCAGGAAACCCTGGATCTGG + Intronic
1076365296 10:129917943-129917965 CTACCAGAGGACCCAGAATGGGG + Intronic
1076606125 10:131691115-131691137 CCCCCAGGGCACCCTCAGTGGGG - Intergenic
1076682314 10:132179471-132179493 CTCCCGCGGAACCCTTACTGTGG + Intronic
1079016102 11:16870235-16870257 CTCCCAGGGAAGCCTCAAATAGG - Intronic
1080145967 11:28984275-28984297 CTCCCTGGGAAACCTGTGTGGGG - Intergenic
1081619850 11:44613059-44613081 CTCCCAGGGAACCCTGTTGGTGG - Intronic
1083049742 11:59766517-59766539 CTCCCTGAGTACCCTGAGTGGGG + Intronic
1083865038 11:65449051-65449073 CCCCCAGGGGCCTCTGAATGGGG - Intergenic
1083877467 11:65531841-65531863 CTGCCAAGGAGCCCTGTATGTGG - Intronic
1083934898 11:65865047-65865069 ACCCCTGGGAACCCTGAATCAGG + Exonic
1084901054 11:72310303-72310325 CTCCCTGAGAATCCTGAAAGAGG + Intronic
1085225014 11:74911889-74911911 AGCCCAGGGTACCCTGAAGGTGG + Intronic
1085407351 11:76271182-76271204 CTCCCAGGGAACCCAGAGGCTGG + Intergenic
1090396002 11:126418713-126418735 TTCCCTGGGAACCCAAAATGGGG - Intronic
1091144149 11:133262712-133262734 CTTCCAGGATACCCTGACTGTGG + Intronic
1092004922 12:5061138-5061160 CTCCCAGGCAACCCTGGACATGG - Intergenic
1092904286 12:13087951-13087973 CTCACTGGGAACCCTGCCTGTGG - Exonic
1094853369 12:34392228-34392250 CTCCCAGGGGACCCTGGGTATGG + Intergenic
1096692894 12:53332065-53332087 TTCCCGGGAAACCCTGACTGGGG - Intronic
1098444892 12:70556310-70556332 CTCCCAGGGAACCAAGGTTGGGG + Intronic
1100867301 12:98870510-98870532 CTCCCAGGCAGGCCTGAAAGTGG - Intronic
1100950887 12:99848017-99848039 GACCCAGGGAAGCCTGAATTGGG + Intronic
1104793560 12:131499763-131499785 CTCCCAGGCAACCCTGAGTGGGG + Intergenic
1104899792 12:132182642-132182664 CTCTCAGGGAACCCAGAGAGAGG - Intergenic
1105281474 13:18965098-18965120 GTCCCCGGGAGCCCTGACTGTGG - Intergenic
1105290673 13:19051071-19051093 GTCCCTGGGAGCCCTGACTGTGG - Intergenic
1106127757 13:26914206-26914228 CTCACAGGGAAACAGGAATGTGG + Intergenic
1106953937 13:34914828-34914850 ATGCCAGTGAACCCTGATTGTGG + Intergenic
1108821481 13:54355947-54355969 CTCCCAGCAAATCCTGAATCAGG - Intergenic
1110866988 13:80407376-80407398 CTGACAGGGAACCCCAAATGTGG - Intergenic
1111838820 13:93424076-93424098 TTCCCAGGGAACCCACCATGGGG - Intronic
1112574932 13:100627232-100627254 CTCGCAGGGAACCCTGAGCAAGG + Intronic
1113183968 13:107664835-107664857 TTCCCAGGGTACCTTGAATTTGG + Intronic
1113191026 13:107746067-107746089 CTCCCAGGGGAAGCTGAATTAGG - Intronic
1114278862 14:21171500-21171522 CTCACAGGCACCCCTGAAAGGGG + Intergenic
1119640201 14:76309048-76309070 CTTGCAGGGAACCCTGTGTGTGG + Intergenic
1120404549 14:84078676-84078698 CTCCCAGCCAATGCTGAATGTGG + Intergenic
1121269814 14:92630694-92630716 CTCCCAGGGTACCCTTAAGGAGG + Intronic
1121754954 14:96394467-96394489 GGCCCAGGGAGCCCAGAATGTGG + Intronic
1122811474 14:104291471-104291493 GCCCCAGGGACCCCTGAAGGGGG - Intergenic
1122859117 14:104574397-104574419 CACCCAGGGAGCCCTGAGTGGGG + Intronic
1123682523 15:22772972-22772994 CTCCCAGGGGACCCGGTAAGTGG + Intergenic
1124475067 15:30026083-30026105 CTCTCAATGAAACCTGAATGTGG - Intergenic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128705536 15:69835166-69835188 CTCCCAGCCAGCCATGAATGAGG - Intergenic
1128793846 15:70450818-70450840 TTCCCAGGGAGCACTGACTGAGG - Intergenic
1130247260 15:82263004-82263026 CTCCTCGGGAACCCTGAGAGTGG + Intronic
1130453385 15:84079951-84079973 CTCCTCGGGAACCCTGAGAGTGG - Intergenic
1131952920 15:97701319-97701341 CTCCCAGGGAACCCTATATGTGG + Intergenic
1133037769 16:3044024-3044046 CTCCCAGGCAGCTCTGAAAGTGG - Intergenic
1135612950 16:23884501-23884523 TTCCCAGGGTGCCCTGGATGTGG - Intronic
1137700714 16:50495851-50495873 ATCCCAGGGAAGCAAGAATGAGG - Intergenic
1138171273 16:54851770-54851792 CTCACAGGGAAAACTGACTGGGG - Intergenic
1138659669 16:58509676-58509698 CTGCCAGGGAAGCCTGTCTGGGG + Intronic
1138674199 16:58639150-58639172 CTTCCAGGGAGGCCAGAATGAGG + Intergenic
1144055511 17:11537218-11537240 CTCCAAGGGGACCCTGAGTCAGG + Intronic
1144168257 17:12633503-12633525 ATCCCAGGGAACTCTGGATCTGG - Intergenic
1145370698 17:22304141-22304163 CTGGCAGGCATCCCTGAATGTGG + Intergenic
1146990040 17:37261593-37261615 CTCACAGAGAAAACTGAATGAGG + Intronic
1147158577 17:38558153-38558175 CTCCCAGGGAAACCAGGTTGCGG + Intronic
1147919635 17:43907792-43907814 CTCCCAAGGATCCCTTAAAGGGG + Intronic
1147987847 17:44316466-44316488 CTCACTGGGAACGCTTAATGGGG + Exonic
1148612017 17:48970949-48970971 TTCCCTGGGAACCCTGAGTCTGG + Intergenic
1148644090 17:49209486-49209508 CTCCCTCTGAGCCCTGAATGTGG + Intronic
1148953392 17:51334202-51334224 CCCCCAGGGAACTCTGAAGCTGG + Intergenic
1149001918 17:51766077-51766099 CTCGTAGGCAACCCTGAATTAGG - Intronic
1150607392 17:66705983-66706005 CTCCCTGGGTATCCTGAAAGAGG + Intronic
1150939205 17:69671825-69671847 TGCCCTGGGAACTCTGAATGGGG + Intergenic
1151259611 17:72906248-72906270 CTCCCGTGGACTCCTGAATGGGG - Intronic
1154164680 18:12005806-12005828 CTGCCAGTGAGCCCTGAAGGAGG - Intronic
1155939156 18:31786188-31786210 CTCTCAGGCACCCCTGAAAGTGG - Intergenic
1159756837 18:72376351-72376373 CTCCAAGGGAATCCTAAGTGGGG - Intergenic
1160238990 18:77109120-77109142 CACCCAGGGAACCCTGGACCTGG - Intronic
1161153676 19:2721638-2721660 TTCCCGGGGAACCCCGAGTGGGG + Intronic
1161976692 19:7611464-7611486 GACCCTGGGAACCCTGAGTGGGG - Intronic
1165509804 19:36259301-36259323 CTGGCAGGCATCCCTGAATGTGG + Intergenic
1165510828 19:36265864-36265886 CTGGCAGGCATCCCTGAATGTGG + Intergenic
1165511330 19:36268283-36268305 CTGGCAGGCATCCCTGAATGTGG + Intergenic
1166224411 19:41386155-41386177 CTCAGAGGGGACCCTGAAAGAGG - Intronic
1166310496 19:41959647-41959669 CTCCCAGGGAAGGCACAATGGGG + Intergenic
926162977 2:10501379-10501401 CTCCCAGGCAACCCTTCAAGTGG - Intergenic
927097040 2:19755197-19755219 GACCCAGAGAAACCTGAATGAGG + Intergenic
927810636 2:26178717-26178739 CTCCCAGGGAACCGTGGGTCCGG + Intronic
927970717 2:27304877-27304899 CTCCTAGGCAACCCTGGCTGGGG + Intronic
928327595 2:30332519-30332541 CTCCAAGGTATTCCTGAATGAGG - Intergenic
929413249 2:41721154-41721176 CTCCCAGGGACCAGTGGATGCGG - Intergenic
931606520 2:64058421-64058443 CTCACAGGCAACCCGGAAGGTGG - Intergenic
934557734 2:95296367-95296389 CTCCCAGGCATCCCTGAGAGAGG - Intergenic
936045991 2:109188366-109188388 CTCCCATGCAACCCTGGAGGTGG - Intronic
936517716 2:113192843-113192865 CTCCCAGTGTACACTGAATAGGG + Intronic
938933444 2:136107649-136107671 TTCACAGGTAACCCTCAATGTGG - Intergenic
941360579 2:164546671-164546693 CTGCCAGGGAACCCAAGATGGGG - Intronic
942085127 2:172436458-172436480 CTCCCAGATCATCCTGAATGAGG - Intronic
943724023 2:191234152-191234174 CACCCAGGGCATCCTGAATGAGG - Intergenic
944062437 2:195583581-195583603 CTCCCAAGAGACCCTGACTGGGG - Intronic
944637754 2:201691068-201691090 CTTCCAGGTAAACCTGAATGCGG - Intronic
946354476 2:219176523-219176545 CTCCCGGGGAACCCTCGATGGGG - Intronic
946524890 2:220507732-220507754 CTGCCAAGGAACCCTAACTGGGG + Intergenic
947128180 2:226894102-226894124 TACCCACGGAACCTTGAATGTGG + Intronic
947481366 2:230503304-230503326 TGCTCAGGGAACCCTGCATGAGG - Intronic
948615468 2:239195811-239195833 CTCCCATTGGACTCTGAATGCGG - Intronic
948726676 2:239938521-239938543 CTCCCAGGGCATCCTGGAAGAGG - Intronic
1168924164 20:1565990-1566012 GTCTCAGGGAACCCTGTATGGGG - Intronic
1169274880 20:4227001-4227023 CTTCCAGAGATCCCTGCATGAGG - Intronic
1173860581 20:46280616-46280638 CTCCCAGGGAACAGTGAGTGAGG - Intronic
1174107429 20:48172531-48172553 CTCCCAGGGATCCCTGGAAATGG + Intergenic
1175831473 20:61967292-61967314 CTGCCAGAGTCCCCTGAATGTGG - Intronic
1176363967 21:6021467-6021489 CTCGTAGGAAACCCTGAATGAGG + Intergenic
1179759551 21:43517078-43517100 CTCGTAGGAAACCCTGAATGAGG - Intergenic
1179887761 21:44321737-44321759 CTCCCTGGCCATCCTGAATGTGG + Exonic
1180041083 21:45280470-45280492 AACCCAGTGCACCCTGAATGCGG - Intronic
1180868195 22:19131708-19131730 GTGCCAGGGAGCCCTGCATGAGG + Exonic
1181054279 22:20252749-20252771 CTCCCAGGGATGGCTGAAAGTGG + Intronic
1181544629 22:23594969-23594991 CTCCCAGGAAACCCTAACTGGGG + Intergenic
1181815684 22:25434926-25434948 CTCCCAGGAAACCCTAACTGGGG - Intergenic
1182219680 22:28748205-28748227 CTCTCAGGGAACACTGGAAGAGG - Intronic
1183291873 22:37007644-37007666 CTCACAAGCAACTCTGAATGGGG + Intronic
1183327111 22:37200220-37200242 ACCCCAGGGGACCCTGAGTGTGG + Intergenic
1184587170 22:45455769-45455791 CACCCAGAGAGCCCTGCATGGGG - Intergenic
1185122080 22:48977340-48977362 CCCCCAGGGACCCTTGAAGGTGG + Intergenic
1185193526 22:49453629-49453651 CTCACAGGGCACCTTGACTGTGG + Intronic
950566489 3:13772580-13772602 CTCCCAGGGTACTCAGAATGGGG + Intergenic
950566899 3:13774809-13774831 CTTCCAGGGCCCCTTGAATGAGG - Intergenic
951073755 3:18364589-18364611 CCCCCAGGGAACCATGAACTTGG - Intronic
952040752 3:29258416-29258438 CTCCCAGGCAACTCTCAGTGGGG + Intergenic
953141118 3:40230337-40230359 CTGACAGGGAGCCCTGTATGTGG - Intronic
954883614 3:53853067-53853089 AGCCCAGGGAACCCTGGATAAGG + Intronic
955352038 3:58200803-58200825 CTGCCTGGGTACCCTGCATGTGG - Intronic
960416717 3:117393886-117393908 CTCCTAGGGAAGCCTGAAAATGG + Intergenic
961650255 3:128413561-128413583 CACCCCTGGAGCCCTGAATGAGG + Intergenic
963404142 3:144840846-144840868 CTGTCAGGGAACCCAAAATGAGG + Intergenic
966701908 3:182862627-182862649 CTACCAGCTACCCCTGAATGTGG - Intronic
966901871 3:184492520-184492542 CTCCCAGGGTAGCCAGAAGGCGG + Intronic
974630934 4:64487919-64487941 GTCCCAGGGGACCCTAAATTTGG - Intergenic
975673428 4:76803955-76803977 CTCCCAAGGAACCCGGGAGGAGG - Intergenic
979822202 4:125188995-125189017 CTCCAAGGGAACCCTGATATTGG + Intergenic
981925638 4:150136637-150136659 CTTCCAGGGAACCTGAAATGTGG + Intronic
983065320 4:163203864-163203886 CACCCATGGAACTCTAAATGAGG - Intergenic
985591846 5:769926-769948 CTCCCAAGGAGCCCTGACCGAGG + Intergenic
985609760 5:880878-880900 CTCCCAAGGAGCCCTGACCGAGG + Intronic
986677237 5:10196779-10196801 CTTGAAGGGAACCATGAATGTGG - Intergenic
990056410 5:51585497-51585519 CTCCCATGGAAGCCAGAAGGAGG - Intergenic
994694784 5:103060534-103060556 CTCGCAGTGAAAACTGAATGTGG - Intergenic
997202411 5:132019200-132019222 TTCCCTGGGAACTCTGAATTGGG + Intergenic
1002409822 5:179064822-179064844 CTCCCTCGGTACCCTTAATGAGG - Intronic
1004406154 6:15335622-15335644 CCCCCAGGGACACCTCAATGTGG - Intronic
1005438542 6:25840188-25840210 TTTCCAGGGAAACCTGACTGAGG + Intronic
1007193040 6:40036206-40036228 CTCCCTGAGGAGCCTGAATGGGG - Intergenic
1011805365 6:91066567-91066589 CTCCCTTGGAACTCTGAATGAGG - Intergenic
1012925341 6:105261836-105261858 CTCCCAGGGGATCCAGAGTGGGG - Intergenic
1014461250 6:121698504-121698526 CCCCCAGGGAACCCTAATTCTGG + Intergenic
1016000247 6:139034148-139034170 CTCCCAGGCAGCAATGAATGTGG + Exonic
1016858479 6:148695242-148695264 CTGCCAGGGGCCCTTGAATGAGG - Intergenic
1018719358 6:166561186-166561208 CTTCCAGGGTCTCCTGAATGAGG - Intronic
1019061976 6:169263260-169263282 CTTCCTGGGGACCCTGAGTGAGG - Intergenic
1019143194 6:169961190-169961212 CTCCAGGGGAACCCAGGATGGGG - Intergenic
1023226071 7:37970381-37970403 TTCCCAGGGCACCCTGACTCAGG + Intronic
1024178476 7:46864089-46864111 CTCCCAGGGCACAGTGAAGGTGG - Intergenic
1024282678 7:47732454-47732476 CTCACAGCGAATCCTGGATGGGG + Intronic
1027237946 7:76309414-76309436 CACCCAGTGAATCCTGTATGGGG + Intergenic
1027537963 7:79430567-79430589 CTCCCAGACAACTGTGAATGTGG - Intronic
1028632879 7:92955206-92955228 CTCCCAGGGCTCCCAGTATGTGG + Intergenic
1032011459 7:128350714-128350736 CACCCAGGGACCCCTGGATGGGG + Exonic
1032017193 7:128387820-128387842 ACCCCAGGGAACCCGGAGTGGGG - Intergenic
1033238676 7:139658994-139659016 CTCCCTGGGAACCCTAGTTGGGG + Intronic
1033628364 7:143133038-143133060 GTCCCAAGAAACCCTGCATGGGG + Intronic
1033926544 7:146469178-146469200 CTCTCAGGGAACCCCAAAGGGGG - Intronic
1035279350 7:157767545-157767567 CTCCCAGGAAACACTGCATTGGG + Intronic
1040964708 8:53072000-53072022 CTCCCAAGGAACCTAGAAAGGGG + Intergenic
1041218560 8:55626221-55626243 ATCCCAGGTAACAGTGAATGAGG + Intergenic
1048916987 8:139194632-139194654 GTCCCAGGGAAGCCTGCCTGAGG + Intergenic
1050248665 9:3719839-3719861 CCCCCATGGAGCCCTGAAAGTGG + Intergenic
1052316558 9:27121988-27122010 CTCCCAGGAAACCTGGAAAGTGG + Intronic
1055488876 9:76784104-76784126 CTCCCAGGGATCTGTGAAAGTGG - Intronic
1056277867 9:85011039-85011061 CTCCCAGGGAACCTGCAAAGGGG + Intronic
1057386121 9:94607102-94607124 CTCTCTGGGAACTGTGAATGGGG + Intronic
1060213433 9:121724228-121724250 CTTCCTGTGGACCCTGAATGGGG + Intronic
1186428867 X:9487322-9487344 CCCCCTGGCAACCCTGAATCTGG + Intronic
1189461682 X:41248472-41248494 CTCCCAGGGGTCCCTGGAGGAGG + Intergenic
1189604496 X:42661762-42661784 CTCCCAGGGAAGCAAGAAGGAGG - Intergenic
1190187219 X:48245759-48245781 CTCCCAGGGACCACTGAAAACGG - Intronic
1190202967 X:48380118-48380140 CTCCCAGGGACCACTGAAAACGG + Intergenic
1190207571 X:48415295-48415317 CTCCCAGGGACCACTGAAAACGG - Intergenic
1190656113 X:52613539-52613561 CTCCCAGGGACCACTGAAAATGG - Intergenic
1192247279 X:69384188-69384210 CTCCCATGCAACTCTGAATTAGG - Intergenic
1195731435 X:107972140-107972162 TTTCCAGGGAACCCTGATTTGGG + Intergenic
1196557516 X:117106806-117106828 CTGCCAGGGAAGCCTGCATCAGG - Intergenic
1199514037 X:148655694-148655716 CTCCCAGGGAACCCTGAATGTGG - Intronic
1199981422 X:152922650-152922672 CTCCCTGGGCATGCTGAATGTGG - Intronic
1200119489 X:153783621-153783643 CTCCCATGGACACCAGAATGTGG - Intronic
1200772758 Y:7142297-7142319 GTCCCATGGAAGCATGAATGTGG - Intergenic