ID: 1199514188

View in Genome Browser
Species Human (GRCh38)
Location X:148656871-148656893
Sequence ATCATACAGAACTGGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199514188_1199514192 16 Left 1199514188 X:148656871-148656893 CCTTGCATCCAGTTCTGTATGAT 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1199514192 X:148656910-148656932 GAAGTTATTTATCCTCTGACAGG 0: 1
1: 0
2: 1
3: 11
4: 132
1199514188_1199514190 -6 Left 1199514188 X:148656871-148656893 CCTTGCATCCAGTTCTGTATGAT 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1199514190 X:148656888-148656910 TATGATTCCGTATCTGTAACAGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199514188 Original CRISPR ATCATACAGAACTGGATGCA AGG (reversed) Intronic
902207005 1:14875971-14875993 ATCACACAGAGCTTGAAGCAGGG - Intronic
903251473 1:22056946-22056968 ATTTTACAGAAAAGGATGCAAGG - Intronic
903852503 1:26316569-26316591 TTCAGACAGACCTGGATTCAAGG + Intronic
905072309 1:35237470-35237492 AACAAACAAAACTGGAGGCAGGG + Intergenic
908072779 1:60481883-60481905 ATTATAAAAAACTTGATGCATGG - Intergenic
910676106 1:89818513-89818535 AACATACAGAACTTGATGAAAGG + Intronic
911310132 1:96282181-96282203 AGCATACAGTACTGGATACTAGG - Intergenic
912957532 1:114165926-114165948 ATCATAAAGAATTGGATGAGAGG - Intergenic
913478321 1:119260425-119260447 ATCATACAGAACTGCATGTTGGG - Intergenic
914386577 1:147175030-147175052 ATTTTACAGAACTGGATGACAGG + Intergenic
914426384 1:147580967-147580989 ATCAAACACACCTGGATGCAAGG - Intronic
916045041 1:160993435-160993457 TTAAGACAGAACTTGATGCAGGG + Intergenic
917196136 1:172467656-172467678 ATGAGACTGAACTGGATCCAAGG + Intronic
918587113 1:186200998-186201020 ATCATACAAAAATGGATGACTGG + Intergenic
920111782 1:203592200-203592222 ATCAGGCAGCACTGGATGAATGG - Intergenic
920536894 1:206743243-206743265 TTCCTACAGATCTGGATTCATGG + Intergenic
922227941 1:223661823-223661845 AACAAAAAGAACTGGAAGCAGGG + Intronic
1063894200 10:10662098-10662120 AGCACACAGCACTGGGTGCATGG + Intergenic
1070995611 10:80777432-80777454 ATCATAGATAACTGGGTACAGGG + Intergenic
1071251786 10:83826347-83826369 GTCATACAGAATTGGAAGAATGG + Intergenic
1075449055 10:122535142-122535164 ATCCTACTGAACTGGAAGCATGG - Intergenic
1084828772 11:71752032-71752054 TTCATACAAAACTGTATCCAGGG + Intergenic
1085149258 11:74235379-74235401 ATTTTAGAGAACTGGGTGCAAGG - Intronic
1085725281 11:78949843-78949865 ACAGTACAGAACTGGGTGCAGGG + Intronic
1087016745 11:93561297-93561319 ATCATAAAGAACTGGAGGCTGGG - Intergenic
1087057865 11:93951251-93951273 ATTATACATAAATGGATGGATGG + Intergenic
1088145558 11:106672169-106672191 GTCACACAGAACTGGAAGGAAGG - Intergenic
1089585992 11:119509994-119510016 GACATACAGAACTAGATGGATGG + Intergenic
1093755533 12:22847946-22847968 ATCATACATCACTGGATTAATGG - Intergenic
1094301785 12:28972508-28972530 ATGATAGAAAACTGGATGGAGGG + Intergenic
1095676361 12:44923513-44923535 ATCATACAGGAATTGAGGCAAGG + Intergenic
1096199000 12:49667857-49667879 ATGAGACAGGACTGTATGCAGGG - Intronic
1099430823 12:82583536-82583558 TTCCTACAAAACTGGCTGCATGG + Intergenic
1100095770 12:91034073-91034095 ATCATACAGAGTTTGGTGCATGG - Intergenic
1103043770 12:117718402-117718424 ATGATCCAGAACTGGATTAATGG + Intronic
1104033942 12:125085413-125085435 ATGAAACAGACGTGGATGCAAGG - Intronic
1104339800 12:127937592-127937614 ATCGTACAGAGCTGGAAGGAAGG - Intergenic
1104877461 12:132045619-132045641 ATCACAGTGAGCTGGATGCACGG - Intronic
1106296930 13:28422916-28422938 ATAATACAGGACTGGAGGGAAGG - Intronic
1107005539 13:35605737-35605759 AGCATAAACAACTGGATTCAAGG - Intronic
1107563897 13:41582737-41582759 ATGATACAGAACAGAATGCATGG + Intronic
1108079922 13:46724638-46724660 ATCATACATAAATGTATGGAAGG + Intronic
1108701139 13:52945276-52945298 ATCAAATCGAACTGGATGGATGG + Intergenic
1112813098 13:103242008-103242030 ACAATACAGAACAGGCTGCAAGG - Intergenic
1113815152 13:113164433-113164455 AACACACAGAACTGTGTGCAAGG + Intronic
1113867048 13:113533185-113533207 ATCATTCAGAGCTCGCTGCAGGG - Intronic
1114145491 14:19972007-19972029 ATAAGACAGAAGTGGATTCAGGG - Intergenic
1116266214 14:42693904-42693926 AACTTATAGAACTGGATCCATGG - Intergenic
1121646467 14:95520716-95520738 AACATACAGGACTGGATTCTCGG + Intergenic
1122534905 14:102455316-102455338 ATCAGACAGCAGTGGGTGCAAGG + Intronic
1124477305 15:30045763-30045785 ATCATACAGCAGTGGACACAGGG - Intergenic
1125415685 15:39449981-39450003 AACAAACAGAGCTGAATGCAAGG + Intergenic
1125978938 15:43982133-43982155 TTCACACAGAACTGTATGGAAGG - Intronic
1126820257 15:52496217-52496239 TTCAGACAGGACTGGAAGCAGGG + Intronic
1129996235 15:80008945-80008967 AACCTACAGAAGTGGAAGCATGG + Intergenic
1130826506 15:87552346-87552368 ATCATACAGAAATGGAAGTTAGG - Intergenic
1134839628 16:17391461-17391483 TTCATGCAGAACTGGCTGAATGG - Intronic
1143652400 17:8271564-8271586 AACACAAAGAACTGGATGAAAGG - Intergenic
1148454176 17:47802073-47802095 AGCCTACAGAACTAAATGCAGGG + Intergenic
1148716102 17:49717325-49717347 ATCAATCAGAACAGGATGTATGG + Intronic
1149278850 17:55078863-55078885 ATCATATGGAAATAGATGCAAGG + Intronic
1154012103 18:10583154-10583176 ATAATACAGATATAGATGCAAGG + Intergenic
1154105919 18:11522987-11523009 TGCATACAGAACTGGAGGAAAGG - Intergenic
1154167926 18:12029807-12029829 ATGAAACAGCTCTGGATGCATGG - Intronic
1155557923 18:27042325-27042347 ATCACACAGACCTAGATCCAGGG + Intronic
1156292046 18:35755806-35755828 CTCATCCAGAACTGGAACCAAGG - Intergenic
1156944317 18:42809580-42809602 TTCATACAAAACTGTATTCAAGG - Intronic
1158577289 18:58649274-58649296 ATCCTAAAGAACTGAAAGCAGGG + Intergenic
1161818097 19:6512480-6512502 TTCATGCAGAGCTGGATGAACGG + Intergenic
1164113844 19:22197025-22197047 ATCATACAGAATTGTGTGCCAGG + Intergenic
1165311691 19:35032408-35032430 AGCAGACAGGACTGGATGCTAGG - Intronic
1165750978 19:38259565-38259587 ATCAAACAGAGCTGGATGAGGGG - Intronic
1167534990 19:50044273-50044295 AGCATGGAGAACTGGATGGATGG + Intronic
926511621 2:13787833-13787855 AACATACAGAACAGGATGCCAGG - Intergenic
927157678 2:20230936-20230958 AGAATACAGGACTGCATGCAAGG + Intergenic
929361107 2:41091768-41091790 ATCAGAGAAAACTGGATGAAGGG + Intergenic
933227924 2:79772455-79772477 ATAGTTCAGAAGTGGATGCATGG + Intronic
933341751 2:81034473-81034495 ATCACCCAGAAGTGGCTGCATGG - Intergenic
936055536 2:109259368-109259390 ATCCTACATACCTGCATGCAAGG + Intronic
938754618 2:134368308-134368330 ACTCTACAGAACTGGCTGCAAGG - Intronic
938776566 2:134546211-134546233 ATCCTAAAGAATTGGAAGCAGGG + Intronic
942745247 2:179224737-179224759 ACCCTACAGGACTGGATTCAGGG + Intronic
943934454 2:193897868-193897890 AACAAACAGAACAGGATGAATGG - Intergenic
946723180 2:222633239-222633261 ATCATAGATAACTGGATACAGGG + Exonic
946865992 2:224041110-224041132 TTGAGACAGAAATGGATGCAGGG - Intergenic
1169538802 20:6577806-6577828 ATCCAACAGAAATGCATGCATGG + Intergenic
1170504802 20:17014185-17014207 ATCATTCATAACTTGAAGCATGG - Intergenic
1174568005 20:51480869-51480891 ATATTACAGAACTGAATGGAAGG + Intronic
1174862341 20:54102666-54102688 AGAATACAAAGCTGGATGCAGGG - Intergenic
1175680875 20:60987773-60987795 AACAGACTGAACTGTATGCATGG - Intergenic
1177857214 21:26413077-26413099 ATTAAACAGAGCTGGAGGCAGGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179123981 21:38575402-38575424 ATGATATAGAAATGAATGCATGG + Intronic
1179776864 21:43670108-43670130 TCCATACAGAAAGGGATGCAGGG + Intronic
951121080 3:18929899-18929921 AGCAGACAGAATTGGATGCATGG - Intergenic
955919350 3:63939213-63939235 ATCTTACAGAACAGGATGGATGG - Intronic
960121237 3:113950142-113950164 ATCATACAGAGCAGCAGGCACGG - Intronic
963550416 3:146714771-146714793 AGCTTAAATAACTGGATGCATGG + Intergenic
965834921 3:172840854-172840876 ATTAATTAGAACTGGATGCAAGG - Intergenic
966311238 3:178596211-178596233 ATCATCTGCAACTGGATGCATGG - Intronic
966557674 3:181282158-181282180 CTCATACAGCACTGAATACATGG - Intergenic
967781875 3:193449229-193449251 ATTCTACAGAACTGAGTGCAGGG + Intronic
968080680 3:195844445-195844467 CTCATACAGAGCTGGAAGAAAGG + Intergenic
970180638 4:13388954-13388976 ATCCCAAAGAACTGAATGCAGGG + Intronic
970532184 4:16996126-16996148 AGCAGATAGAACTGGATGTAGGG - Intergenic
972455785 4:39253480-39253502 ATAATATAGAACTGCATGCTGGG + Intronic
972751654 4:41995398-41995420 ATCATTCAGCATTGGATGCCAGG + Intronic
973721654 4:53730287-53730309 ATCAGACAGAACGGGATTAATGG + Intronic
973790489 4:54373902-54373924 ATCATACAGAAATGCCAGCAGGG + Intergenic
978082521 4:104611954-104611976 ATCATACTGAATTGGGGGCAGGG - Intergenic
979769006 4:124499316-124499338 AGACTACAGAACAGGATGCATGG + Intergenic
980570578 4:134611486-134611508 TTCTTACAGTTCTGGATGCAAGG - Intergenic
981667712 4:147248336-147248358 AGCAAACAGAAGTGGATGGAGGG - Intergenic
983290083 4:165790849-165790871 ATCTTACAGTAATGGATGTATGG + Intergenic
984894580 4:184526561-184526583 ATCATGGAGAATTGGAGGCAGGG + Intergenic
984957455 4:185059675-185059697 ATCAAAAAGAACTGAAAGCAAGG - Intergenic
987944827 5:24591858-24591880 ATCATAAAGTACTAGATGAAGGG + Intronic
988709300 5:33757450-33757472 ATCATGCAGAATTGGAAGCTGGG + Intronic
988970510 5:36462841-36462863 ATCATGCAGCATTGGAGGCATGG + Intergenic
993682777 5:90899941-90899963 CTCTCAAAGAACTGGATGCAAGG - Intronic
996210702 5:120805646-120805668 AACATACAGAAGTGGTTACAGGG + Intergenic
998721868 5:144961357-144961379 AGGATATAGAAATGGATGCAAGG + Intergenic
999589879 5:153133203-153133225 ATCAAAAAGAACTGGATGTATGG + Intergenic
1000738799 5:164939024-164939046 TCCATACAGTACTGGATTCATGG + Intergenic
1000836814 5:166165385-166165407 ATCATACAGGTCTAAATGCACGG - Intergenic
1001013605 5:168120521-168120543 ATTATACACAGCTGTATGCATGG + Intronic
1002720390 5:181257037-181257059 ATCAGGCATAACTGGATGCCTGG - Exonic
1004498328 6:16185749-16185771 TTCATAAAGCACTGGATTCATGG + Intergenic
1007575386 6:42922384-42922406 ATCATAGACAAGTGGATGGAAGG + Intronic
1007645286 6:43375270-43375292 ATCCTACAGAAATGCATACAAGG + Intergenic
1010597253 6:77778828-77778850 ATCATTAACAACTGGGTGCATGG + Intronic
1011162988 6:84413132-84413154 ATCCAACAGGACTGGATCCAGGG - Intergenic
1011491971 6:87901587-87901609 TTCATGCAGAACTGGCTGTATGG + Intergenic
1013307008 6:108858202-108858224 ATGACTCAAAACTGGATGCATGG - Exonic
1015090658 6:129353392-129353414 ATGAGACAGAACTGGAATCAAGG - Intronic
1017512401 6:155125977-155125999 ATCATAAAGAATTGAAAGCAGGG + Intronic
1020530184 7:9323235-9323257 ATCAAATAGAACTCCATGCAGGG - Intergenic
1020939982 7:14520496-14520518 AACATACAAAACTTTATGCAAGG - Intronic
1021565699 7:22014407-22014429 ATCCTACAAAGCTGGATGCTAGG - Intergenic
1022782499 7:33600793-33600815 ATCATCCAGAGATGGAGGCATGG - Intronic
1023154623 7:37236205-37236227 CTCAGACAGAACAGGCTGCAAGG + Intronic
1025948762 7:66126422-66126444 ATGAGACTGAACTGGATGAATGG - Intronic
1026203411 7:68234677-68234699 AACTTACACAACTGTATGCAGGG + Intergenic
1027643091 7:80762206-80762228 ATAATTCAGAATTGGATCCACGG + Intronic
1036772182 8:11586886-11586908 AGCTTACAGAACTGAAGGCAAGG + Intergenic
1037719097 8:21427521-21427543 ATCAGACAGAACTAGTTACAGGG + Intergenic
1041833774 8:62187172-62187194 AGAATACAGCACTGGATGCCAGG - Intergenic
1047076505 8:121410255-121410277 ATCAAATAAAACTGGGTGCAAGG + Intergenic
1050170774 9:2814145-2814167 AGCATACAGAACTTGTTACAAGG + Intronic
1052039029 9:23716992-23717014 ATCAGACAGAAATGTATGGAAGG + Intronic
1052134841 9:24897357-24897379 ATGATACAGAAGTGGAGACATGG + Intergenic
1053260147 9:36655778-36655800 GTCATTTGGAACTGGATGCATGG - Intronic
1053377802 9:37622769-37622791 ATTAAACAAAATTGGATGCAAGG + Intronic
1057095495 9:92304401-92304423 ATCAAACAGAACTGCACTCAAGG + Intronic
1060375641 9:123113510-123113532 ATCATACAGAACAGGGCTCAGGG - Intronic
1185695851 X:2193968-2193990 ATGATAGAGAAATGGATGGATGG - Intergenic
1189114443 X:38328266-38328288 ATCAGACACAATTGGATTCAGGG + Intronic
1190822793 X:53989813-53989835 CTCATACAGAGCTTGATCCATGG + Intronic
1191043716 X:56113781-56113803 CTCATACAGCTCTGGATGAAGGG - Intergenic
1191053206 X:56216250-56216272 ATCATAGAGAACTGATTGGAAGG - Intergenic
1194316888 X:92388063-92388085 AACATACAGAATTAGATGGATGG + Intronic
1194464880 X:94221307-94221329 AGCATAGAGAACAGGATGGAGGG + Intergenic
1195979229 X:110560446-110560468 ATCACGCAGAACTGGATGGAGGG - Intergenic
1196495985 X:116326112-116326134 AGCATACTTAACTGGAAGCAGGG - Intergenic
1199514188 X:148656871-148656893 ATCATACAGAACTGGATGCAAGG - Intronic
1200625062 Y:5501385-5501407 AACATACAGAATTAGATGGATGG + Intronic
1201235275 Y:11904014-11904036 ATAATACATGAATGGATGCATGG + Intergenic