ID: 1199515517

View in Genome Browser
Species Human (GRCh38)
Location X:148670768-148670790
Sequence GCACACTGAAAAAGAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 333}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199515517_1199515523 13 Left 1199515517 X:148670768-148670790 CCATCCATTCTTTTTCAGTGTGC 0: 1
1: 0
2: 4
3: 30
4: 333
Right 1199515523 X:148670804-148670826 TTTCTAAAGTAATGCCGAACTGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199515517 Original CRISPR GCACACTGAAAAAGAATGGA TGG (reversed) Intronic
901093635 1:6660762-6660784 GCCCAGTGAACAAGAATGAAGGG - Intronic
901276470 1:7995252-7995274 TAACAATGAAAAAGAAAGGAAGG - Intergenic
903657023 1:24955744-24955766 GGACACTGAAAAACACTGGGGGG + Intronic
905949659 1:41938542-41938564 GAACACTCAAAAAGAAAGTAAGG + Intronic
906136847 1:43506054-43506076 GCACACAGAAAGAGAAGGCAAGG - Intergenic
906512931 1:46421613-46421635 GCTCTCTGAACAACAATGGAGGG + Intergenic
908551500 1:65213330-65213352 GCAAACTGAAAACCAGTGGAAGG + Intronic
908957032 1:69644513-69644535 GTACACTGAAAATAAAAGGATGG - Intronic
909592926 1:77371785-77371807 GCAGACTAAAGAATAATGGAGGG + Intronic
909988472 1:82191927-82191949 GAACACTGAAAATGAATGGTAGG - Intergenic
910037295 1:82803698-82803720 GAACACTGAACATGAGTGGAAGG + Intergenic
910326214 1:86010994-86011016 GAACACTGAAAAAGAATAAGAGG + Intronic
910341081 1:86188688-86188710 GAACAGAGAAAAAGAATTGAAGG - Intergenic
910969987 1:92846175-92846197 GCACACAGAAAAAAAATTCATGG + Intronic
911317482 1:96372293-96372315 GAACAATGGAAAAGAATGGAGGG + Intergenic
911417875 1:97598587-97598609 GTTCTCTGAAAAAGAAGGGAGGG + Intronic
911451346 1:98064983-98065005 TCACACTGAAAAAAAATTGTAGG - Intergenic
916172275 1:162010102-162010124 GCACACTGAAGAAGAGGGAAGGG + Intronic
916283211 1:163075459-163075481 GCACCCAGGAAAAGAAGGGAAGG - Exonic
916899590 1:169206354-169206376 AGAGACTGAAAAAGAATGGATGG + Intronic
917103255 1:171466995-171467017 GCGAAATGAAAAAGAATGTAGGG - Intergenic
918665946 1:187151685-187151707 ACACACTGAAAACAAAGGGATGG - Intergenic
919218546 1:194593999-194594021 TCACACTGAAAATAAATGCAAGG - Intergenic
920388245 1:205582760-205582782 GCACACTCAAAAAGAAGTCAAGG - Intronic
920990380 1:210932637-210932659 ACAGACTGAAAAAGAAGGAATGG + Intronic
921165075 1:212501008-212501030 GCACACTGAGAAACAATTCAAGG - Intergenic
921501828 1:215913683-215913705 GGATACTGAAAAGGAATGAATGG + Intronic
921673657 1:217953389-217953411 GCAGACTAAAAGAGGATGGAAGG - Intergenic
921705736 1:218321082-218321104 GAACACTGAAAAAGAAGGTTTGG - Intronic
922763275 1:228145272-228145294 GCACACGGGAGACGAATGGAAGG - Intronic
922918629 1:229280405-229280427 CCACACAGAAAAAGAATTGATGG + Intronic
923707522 1:236356583-236356605 GCACAGTTAAAAACAATGGTGGG + Intronic
924213922 1:241799812-241799834 GGAGACTGAAAAAGATGGGAAGG - Intronic
924372718 1:243370261-243370283 GAACACTGAAAAAGCATGATAGG + Intronic
924670716 1:246122107-246122129 ACACACTTATAAAGAATGCAGGG + Intronic
924828724 1:247570055-247570077 ACACACTAAAAAATAATAGAGGG - Intronic
1063289983 10:4735191-4735213 GCAAACTGAAAGAGGAAGGAAGG - Intergenic
1064042559 10:11980865-11980887 GGACACTGAAAAAAGAAGGATGG + Intronic
1064732627 10:18348434-18348456 GAACTCAGAAAAAGGATGGATGG + Intronic
1065038684 10:21667451-21667473 GAATACTCAAAAAGAATGGGAGG - Intronic
1068069480 10:52178854-52178876 ACAGACTGAAAAGGAAGGGATGG - Intronic
1068624015 10:59220250-59220272 ACACCATGAAAAAGAATGGGAGG + Intronic
1069806367 10:71127469-71127491 GCACACGGAAACAGAATGAGGGG - Intergenic
1071442347 10:85712286-85712308 GCACACTGAAAGAAAAAAGATGG + Intronic
1071452791 10:85814226-85814248 GCAGATTGAAAATAAATGGATGG + Intronic
1071514567 10:86288750-86288772 GCACACTGAAGAAGAGGTGACGG - Intronic
1071936599 10:90538642-90538664 GCCCACTGAAAAAGAATCTTTGG - Intergenic
1072711441 10:97718200-97718222 GCACAATGAGATAGAATGGGAGG - Intergenic
1073484869 10:103810380-103810402 GCACACTGACAAATCACGGAGGG + Intronic
1073771899 10:106743907-106743929 GAACACTGAAAAAGTACTGAAGG - Intronic
1073787927 10:106910724-106910746 GCACACTGAAGGACCATGGATGG - Intronic
1074076764 10:110134596-110134618 GCCAAATGAAAAAGAATGAAAGG + Intronic
1074213112 10:111356435-111356457 GCCCACTTTCAAAGAATGGAAGG - Intergenic
1074624275 10:115162771-115162793 GGAGACTGAAAAAGAATGACTGG + Intronic
1077781864 11:5338922-5338944 ACACACTGAAAAAATATGTATGG - Intronic
1077945193 11:6889775-6889797 GCAAGCTGAAAAAGGATAGAAGG - Intergenic
1078525694 11:12099412-12099434 GCAGAGAGAAAAAGCATGGATGG + Intronic
1078855749 11:15205556-15205578 GGACTTTGAAAATGAATGGAAGG + Intronic
1079652011 11:22941985-22942007 GGACACTGAAAAAGCATGATTGG - Intergenic
1080072037 11:28100767-28100789 GAATACTGAAAAGGAAGGGATGG + Intronic
1081296085 11:41391191-41391213 GAACACTGAAGAAGAAGGCAGGG - Intronic
1083339631 11:61950633-61950655 ACACACAGGGAAAGAATGGAGGG + Intronic
1085108197 11:73864295-73864317 GCACACTGAAGAAGACTTCAAGG + Exonic
1085571857 11:77566374-77566396 AAACACTGAAAATAAATGGATGG - Intronic
1085874171 11:80386173-80386195 TCATACTGAAAAATAGTGGAGGG - Intergenic
1086688834 11:89765418-89765440 GCATACTGAAAACTAATGCAAGG + Intergenic
1086717022 11:90074537-90074559 GCATACTGAAAACTAATGCAAGG - Intergenic
1087589549 11:100169146-100169168 GAACACTGATAAAGAAAGAAAGG + Intronic
1089263143 11:117236574-117236596 GTACACTGGAAAAGAGTTGAGGG - Intronic
1089789778 11:120934300-120934322 GCTGTCTGAAAAAGAAGGGAGGG + Intronic
1090590642 11:128263160-128263182 ACAAACTGAAAAAGAACAGATGG - Intergenic
1092129098 12:6096082-6096104 GGAGACTGAAGAAGGATGGATGG + Intronic
1092274357 12:7048011-7048033 AGACTCTGAAAAAGAAAGGAAGG - Intronic
1092619918 12:10252775-10252797 TGACACTGAAGAAGAATGGTGGG + Intergenic
1093833021 12:23789112-23789134 GCACACAGAAAAGAAAAGGAGGG + Intronic
1094148876 12:27259862-27259884 AGACACAGAAAAAGAAAGGAGGG - Intronic
1094630819 12:32172070-32172092 GCAAACAGAAAAGGAACGGAGGG - Intronic
1094701639 12:32876049-32876071 GAACACTAACAAAGAATGGCTGG + Intronic
1095321213 12:40829862-40829884 GGAAAATGAGAAAGAATGGAGGG + Intronic
1095736088 12:45557652-45557674 ACAGACTGCAAAAGATTGGATGG + Intergenic
1097398090 12:59100696-59100718 GAGCTCTGAAAGAGAATGGAAGG + Intergenic
1097399084 12:59107956-59107978 GAGCTCTGAAAGAGAATGGAAGG - Intergenic
1097506965 12:60485637-60485659 GCCCTCTGAATAAGCATGGAAGG - Intergenic
1097771440 12:63591076-63591098 GCATTCTAAAAAAGAATGAATGG - Intronic
1098142635 12:67466536-67466558 ACAGACTGAAAATAAATGGATGG - Intergenic
1098321433 12:69248312-69248334 GGAAAGTAAAAAAGAATGGAAGG - Intronic
1098491786 12:71090490-71090512 GTAGACTGAAAATGAAGGGATGG - Intronic
1098828055 12:75323919-75323941 GCACACTGAAACAGCCTTGATGG + Intronic
1099369426 12:81811808-81811830 GCCCAGTGAGAAGGAATGGATGG - Intergenic
1101622862 12:106406942-106406964 GCTGACTGTAAAATAATGGAAGG + Intronic
1103472837 12:121195529-121195551 GCATCCTAAAAAAGAATGTATGG - Intergenic
1104065027 12:125299154-125299176 GAACAAGGTAAAAGAATGGATGG - Intronic
1107293487 13:38884249-38884271 GCACACTGGAAAAGAATTAGAGG - Exonic
1107364398 13:39655193-39655215 GTACAGTGAAAGAAAATGGAGGG - Intergenic
1107893315 13:44933216-44933238 GCACACTGAGGAAGCATGGCTGG + Intergenic
1108293348 13:48985740-48985762 GCACAGAGAAAAAGACTGGAAGG + Intronic
1108632051 13:52293905-52293927 GGACACTGAAACAGATTGAAGGG - Intergenic
1108654647 13:52518689-52518711 GGACACTGAAACAGATTGAAGGG + Intergenic
1108692676 13:52873479-52873501 GCACAGTGAAAAGGAATAGAGGG - Intergenic
1109478969 13:62922585-62922607 GAAGACAGAAAAAAAATGGAAGG + Intergenic
1109892960 13:68642072-68642094 ATACACTAAAAAAGAATGCATGG - Intergenic
1110396865 13:75040248-75040270 GCAGACTGAAGGAGAAAGGAAGG - Intergenic
1110451176 13:75638262-75638284 GCATACTAAAAAAAAAGGGAAGG - Intronic
1111737073 13:92155247-92155269 GCTTATTGAAAAAAAATGGAAGG - Intronic
1113374932 13:109756304-109756326 TCACTCTGAAAAAGAAAGGAGGG + Exonic
1113756963 13:112819097-112819119 GGACACTGGGTAAGAATGGAAGG + Intronic
1114412468 14:22514046-22514068 GTACACTGAAAAATAATTCAAGG - Intergenic
1115365520 14:32552811-32552833 ACACACTGAGAAAGAAGGGAGGG + Intronic
1115834780 14:37389204-37389226 AAACACTAAAAAAGAATGAAGGG + Intronic
1118542561 14:66844599-66844621 GGATACGGAAAAAGTATGGATGG + Intronic
1120602951 14:86534868-86534890 TCACACTGAATTACAATGGATGG - Intergenic
1120823500 14:88934495-88934517 GCTCACTGAAAAATCATAGAGGG - Intergenic
1120858215 14:89231478-89231500 TGAGACTGAAAAAGAATGCAGGG + Intronic
1120988626 14:90355490-90355512 GAGCACTGGCAAAGAATGGAAGG + Intergenic
1121973553 14:98381714-98381736 GCACACTGAAGAAGTATGCCTGG - Intergenic
1121978862 14:98434653-98434675 GCACACGGAAAAAGATTGATAGG - Intergenic
1123764616 15:23465773-23465795 ACAAACTGAAAATGAAGGGATGG + Intergenic
1124721763 15:32116852-32116874 GCACACTCAATGAAAATGGATGG - Intronic
1124989489 15:34657453-34657475 ACACACTGAAAAACACTGGGTGG + Intergenic
1125010290 15:34864968-34864990 GCACACTGACAAACAATGGATGG + Intronic
1125639082 15:41214630-41214652 CCACAGTGAAGAAGAATGGTAGG - Intronic
1126263833 15:46729120-46729142 GCACTTTGAAAAAAAATGTAGGG - Intergenic
1126321812 15:47432174-47432196 TCACACTGAAAATAAATGGCAGG + Intronic
1126431256 15:48587412-48587434 GCACAGTTCAATAGAATGGAAGG + Intronic
1126500196 15:49336859-49336881 GCATACTGTAAGAGAAGGGAAGG - Intronic
1126807228 15:52363211-52363233 GAACACTGAAAAAGAAGAAAAGG + Intronic
1127848885 15:62896213-62896235 GCTCACTGGAAAAGAATGTGGGG + Intergenic
1128526736 15:68417377-68417399 GCACATTGGAGAGGAATGGAGGG - Intronic
1129788440 15:78324257-78324279 ACAGACTGAGAAAGAATGTATGG + Intergenic
1131627797 15:94142159-94142181 AAAAACTGAAAAAGAAAGGAAGG - Intergenic
1132401443 15:101509621-101509643 ACACAGAGAAAAAAAATGGAAGG - Intronic
1132874689 16:2131179-2131201 GCACAAGGAAAAAGAGAGGAAGG + Intronic
1134115352 16:11543816-11543838 CCACACTGCATAACAATGGAAGG + Intergenic
1134553631 16:15150012-15150034 GCACAAGGAAAAAGAGAGGAAGG + Intergenic
1135515430 16:23128510-23128532 GAAAACTGAAAAATAAAGGAGGG + Intronic
1138755819 16:59483609-59483631 ACAGACTGAAAATGAAAGGATGG - Intergenic
1139034150 16:62922919-62922941 ACACACTCAAAAACAATGGATGG - Intergenic
1139180024 16:64736088-64736110 TAACTCTGAAAAATAATGGAGGG - Intergenic
1139307579 16:66000531-66000553 GCACACTGAAAAATCATCCAAGG - Intergenic
1140991397 16:80215829-80215851 ACAGACTGAAAGAGAAGGGATGG - Intergenic
1142187919 16:88703270-88703292 ACACACTGGAAACGACTGGATGG + Intronic
1142328347 16:89433286-89433308 GCAGACTGAAAGAGCCTGGAGGG - Intronic
1144565680 17:16357250-16357272 GATCACTGGAACAGAATGGAGGG + Intergenic
1148198308 17:45730616-45730638 GCACACTGGGGCAGAATGGAAGG + Intergenic
1149018055 17:51931798-51931820 TGACACTGAAAATGAGTGGACGG - Intronic
1151221754 17:72617977-72617999 GCAGACTGAAAAAGTCTGGCTGG + Intergenic
1151228137 17:72661798-72661820 GCAGACTGTAAGGGAATGGATGG - Intronic
1151867827 17:76816073-76816095 GAAGACAGAAAAAGAAAGGAAGG + Intergenic
1152024043 17:77797195-77797217 GGAGATGGAAAAAGAATGGAGGG - Intergenic
1153922028 18:9800320-9800342 GCACGGTGGAAAAAAATGGAAGG - Intronic
1154125207 18:11686737-11686759 GATCACTGAACAACAATGGATGG - Intergenic
1154211892 18:12386369-12386391 GCAAAAAGAAAAAGAAAGGAAGG - Intergenic
1155011449 18:21783129-21783151 GCAGACTGAAAGTGAAGGGATGG - Intronic
1156702978 18:39846769-39846791 GCTTACTGAAAAAGAAAAGATGG - Intergenic
1156780287 18:40842760-40842782 GCACAGTGAAAAAGATTCAAGGG - Intergenic
1156797961 18:41071351-41071373 GCTCACTGAGAAAGGATGCATGG - Intergenic
1157546953 18:48553393-48553415 GCAAACGGAAACAGGATGGAGGG - Intronic
1158097523 18:53790949-53790971 TGACACTGAAAATGAATGAAAGG + Intergenic
1158154728 18:54412721-54412743 ATTCACTGAAAAAGAAAGGAGGG - Intergenic
1158983529 18:62789577-62789599 AGACACTGATGAAGAATGGAGGG - Intronic
1159046605 18:63374945-63374967 TGACAATAAAAAAGAATGGATGG + Intergenic
1160414772 18:78700881-78700903 GCACACTTTAAAAGAATGAGTGG + Intergenic
1160446908 18:78935091-78935113 GCAGGCTGAATAACAATGGAAGG - Intergenic
1161826597 19:6571241-6571263 ACAGACTGAAAATGAAGGGATGG - Intergenic
1164533650 19:29067343-29067365 GCACAGAGAAAAATAATTGAAGG + Intergenic
1165219943 19:34307251-34307273 GCTCACTACAAAAGAATGGCAGG - Intronic
1167119152 19:47506498-47506520 TCACACTCAAAAAGAAGGGAAGG - Intronic
1167422594 19:49412991-49413013 GCACCCTGAAGAAGGAAGGAAGG + Exonic
1168498945 19:56877239-56877261 GCTCCCTGAATAAGAATGGCGGG - Intergenic
928485964 2:31731813-31731835 ACAGACTGAAAATGAAGGGATGG + Intergenic
930820952 2:55646214-55646236 GCAAAGTGGAAAAGAATGAAGGG + Intronic
930838525 2:55820884-55820906 GACCAGTGAAATAGAATGGAGGG + Intergenic
930880961 2:56269746-56269768 GCTCACTTAAAAAAAATGAAAGG - Intronic
931128066 2:59299488-59299510 AAACACTGATAGAGAATGGAAGG + Intergenic
933332963 2:80918305-80918327 GCAGACTGAAAATAAAAGGATGG - Intergenic
935426783 2:102927857-102927879 GCACACTGAAAACACATGGAGGG + Intergenic
935545117 2:104392919-104392941 GCATACTGAAAAATAATTCATGG - Intergenic
936157544 2:110058240-110058262 GCACACCCAGAAAGACTGGAGGG + Intergenic
936187148 2:110313204-110313226 GCACACCCAGAAAGACTGGAGGG - Intergenic
937044585 2:118844415-118844437 GCCCACTGAGAAAGGAGGGAGGG + Intronic
939067325 2:137499232-137499254 GTACACTGTAATAGAATAGATGG - Intronic
939899454 2:147834185-147834207 TCACACTAAAAGAGAATGTAAGG - Intergenic
940747101 2:157579981-157580003 GCTAAATGAAAAAGAATGAAAGG - Intronic
940923817 2:159341150-159341172 GTAGACTGAAAGTGAATGGATGG + Intronic
941364822 2:164597643-164597665 GCAGGGAGAAAAAGAATGGAGGG + Intronic
941510859 2:166407619-166407641 GCATAATGAAAAAGTTTGGAAGG - Intronic
942261306 2:174167058-174167080 GTAAACTGAAAAAGAAGAGAGGG + Intronic
942898454 2:181086614-181086636 GCAAACTGAGAAAGTATGAATGG - Intergenic
943525799 2:189015655-189015677 TTACACATAAAAAGAATGGAAGG + Intergenic
943600079 2:189906964-189906986 GCACAGGCAAAAAGACTGGAGGG + Intronic
943859185 2:192837770-192837792 GCACACTGACAAAAAAAGGCAGG - Intergenic
945151198 2:206793865-206793887 GCACATTGAAACAGAAGAGATGG + Intergenic
945455840 2:210051023-210051045 GCACACTTGAAAAGAGTGTATGG - Intronic
945735194 2:213590014-213590036 GCAAACTGAAGAAGAATGGGAGG - Intronic
946708699 2:222485140-222485162 GCGCAGTGGAAAAGAATGGATGG - Intronic
947754202 2:232550227-232550249 GCATTCTGAAAACAAATGGAGGG - Exonic
1170831901 20:19850194-19850216 GCACTCAGAAAAAGTATGGAGGG - Intergenic
1173259644 20:41422226-41422248 GGAAACTGAAAAAGAATGGAAGG + Intronic
1173415771 20:42854479-42854501 GCACACTGTGACAGAATGGGTGG + Intronic
1173872804 20:46352352-46352374 GCCCAGAGAAAAAGCATGGAAGG + Intronic
1177359750 21:20052739-20052761 GCAGAGTGAACAAGAATAGAAGG - Intergenic
1178679548 21:34661012-34661034 GAACACAGAAAAACAATGCAAGG + Intergenic
1180684340 22:17653357-17653379 GAACACTGAAAAGGGAAGGATGG - Intronic
1180730530 22:17978825-17978847 GTACACTTAAAATGAATGAATGG + Intronic
1183162352 22:36123378-36123400 GCACATTGACCAAGGATGGATGG - Intergenic
1183772481 22:39938801-39938823 GCACACAGGACAGGAATGGATGG + Intronic
1183906843 22:41047930-41047952 CTATACTGAAAAAGAAAGGAAGG - Intergenic
1184327892 22:43805078-43805100 ACAAACTGAAAAAGAAAGCAAGG + Intronic
949622872 3:5835477-5835499 TCACACTAAAAAAGATAGGAAGG - Intergenic
949656075 3:6221499-6221521 ACCCACTGAAAAAGAAAAGATGG + Intergenic
950930517 3:16784335-16784357 GCACATTGAAAAATAAAGAAGGG + Intergenic
952569251 3:34694506-34694528 GCAGAAAGAAAAAGAAAGGAAGG - Intergenic
953531624 3:43745047-43745069 GCACATTGAAAATGAAGGAAGGG - Intergenic
953961659 3:47270636-47270658 GCACAGGAAAAAAGACTGGAAGG + Intronic
958905193 3:99934255-99934277 CCACATTGCAAAGGAATGGAAGG + Intronic
958976756 3:100676953-100676975 ACAGACTGAAAATAAATGGATGG - Intronic
959205612 3:103303053-103303075 GCAGACTGAAAATAAAGGGATGG - Intergenic
960200320 3:114826615-114826637 GTGCACTGAAAAAAAGTGGAGGG - Intronic
960788917 3:121404824-121404846 GCAAACTAATAAAGAAGGGAAGG - Intronic
960791338 3:121434573-121434595 CCACACTGAAAATGAATGAGGGG + Intronic
960954560 3:123022783-123022805 GCTCACTAAAACAGAAGGGAAGG + Intronic
962139519 3:132773575-132773597 GTTCACTGAAAAAGCATGGCTGG - Intergenic
962874109 3:139522701-139522723 GCAGAGTGAAAAAGGATGAAAGG + Intronic
964804315 3:160590228-160590250 ACAGACTGAAAATAAATGGATGG + Intergenic
966126194 3:176579627-176579649 GGACTCTGAAAAACAATGGTAGG - Intergenic
966396246 3:179506557-179506579 TGACAATGAAAAAGAAAGGATGG + Intergenic
967456845 3:189697382-189697404 GATCAATGAAACAGAATGGAAGG - Intronic
967920224 3:194609015-194609037 GGACTCTCAAAAGGAATGGATGG + Intronic
968148134 3:196317138-196317160 ACACACTGAAAAAAAATGTCAGG - Intronic
968148141 3:196317251-196317273 ACACACTGAAAAAAAATGTCAGG - Intronic
969726910 4:8924679-8924701 AGACACTGAAAATGAAGGGATGG + Intergenic
970353739 4:15232052-15232074 GGAAACTGAAAAAGTAGGGAAGG - Intergenic
973726521 4:53782412-53782434 ACACACTGGCAAAAAATGGAGGG + Intronic
973836551 4:54815845-54815867 GCAGAATGGAGAAGAATGGAGGG - Intergenic
973917141 4:55646784-55646806 GAAAACTGAAAAAAAATGTAAGG + Intergenic
975194126 4:71503171-71503193 ACAGACTGAAAATGAAAGGATGG - Intronic
975257955 4:72260957-72260979 GTATAATGAAAAAGAATAGATGG - Intergenic
975649926 4:76582865-76582887 GCACACTGGACCAGAAGGGAGGG - Intronic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
977738846 4:100452587-100452609 GCACACTGTAAAGGATTGGCAGG - Intronic
978117380 4:105036891-105036913 ACACACTGAAAATAAAGGGATGG + Intergenic
978611735 4:110548488-110548510 TCAAATTGAAAAAGAATAGACGG - Intronic
978908542 4:114038285-114038307 GCAAAATGAAGAAGGATGGAGGG + Intergenic
978957543 4:114633114-114633136 CCACACTTAAAAAGGATAGATGG + Intronic
979106288 4:116692215-116692237 GCAAATTAAGAAAGAATGGATGG + Intergenic
982211419 4:153039579-153039601 GCAAAGTGAAAAACAATGCATGG - Intergenic
982651374 4:158091524-158091546 GGAAAATGAAAAATAATGGAAGG + Intergenic
982782079 4:159501642-159501664 GCACATTCAAAAAGATTAGATGG - Intergenic
983565632 4:169148457-169148479 GCATAAGGAAAAAGAATGGAAGG + Intronic
983827255 4:172278774-172278796 TGAAACTGAAAAAGAATTGAAGG + Intronic
984600622 4:181722155-181722177 GGACACATAGAAAGAATGGAAGG + Intergenic
985072120 4:186176577-186176599 GCAGACTGAGAAAGAATGGCTGG + Intergenic
985121332 4:186645664-186645686 GCACAGTGGATAAAAATGGATGG + Intronic
986231514 5:5868444-5868466 GGACCCTGAAAAGGAATGCAGGG - Intergenic
986562537 5:9076771-9076793 GGAAAGTGAAAATGAATGGATGG - Intronic
986779206 5:11048758-11048780 GCCTACTGAAAAAGATTGGAAGG + Intronic
987776997 5:22380137-22380159 GAACAAAGAAAAAGAAAGGAGGG + Intronic
988469064 5:31520047-31520069 GAACACTAAAAAAAGATGGAAGG - Intronic
990690532 5:58358878-58358900 GCCCACTGAAAAAGAAGAGTGGG - Intergenic
992636197 5:78727947-78727969 GCACTCTGAAAGAGTATGAAAGG + Intronic
992663359 5:78983432-78983454 TCAGATTGCAAAAGAATGGAAGG - Intronic
993882491 5:93379514-93379536 GGACACTGTATAAGAAAGGAGGG - Intergenic
994814043 5:104561012-104561034 GAACTCTGAAAAGTAATGGAAGG - Intergenic
995079147 5:108026791-108026813 TCACACTGAGAAGTAATGGAAGG + Intronic
995580408 5:113594443-113594465 ACATACTGAAAAAAAATGGAAGG - Exonic
998007870 5:138669185-138669207 GCTCACCTAAAAAGAATGAAAGG + Intronic
1002358638 5:178651902-178651924 GTACCTTGAAAAAGAATAGATGG - Intergenic
1002861474 6:1083630-1083652 ACACAGGGAAAAAGAATAGAGGG + Intergenic
1003088888 6:3084374-3084396 GCACACTGACAAAGAAGGGAGGG - Intronic
1003465134 6:6372178-6372200 ACACAATGAAAAAAAATGCAAGG + Intergenic
1003878556 6:10459959-10459981 GCACACTGAAGAAGACTTCAAGG - Intergenic
1007469824 6:42082021-42082043 GTACACTGAAACTGAATGCAAGG - Exonic
1007565181 6:42844580-42844602 GCACACTGAGAAGGAAGGTAAGG + Intronic
1007810429 6:44481777-44481799 GCACAATAAAAAAGCCTGGAAGG - Intergenic
1007900237 6:45404524-45404546 ACACTATCAAAAAGAATGGATGG - Intronic
1008222410 6:48871847-48871869 GAACAATGAAACAGAATAGAAGG - Intergenic
1008682213 6:53884625-53884647 GCAGACTAAGAATGAATGGAAGG - Intronic
1008744010 6:54646781-54646803 TCAAACTGAAAAAGAATGGTTGG + Intergenic
1009582177 6:65550055-65550077 GCTCAGTGAAAAATAATGGATGG - Intronic
1011864748 6:91810842-91810864 GCACACTGAAAAAGAAAGATAGG - Intergenic
1013652568 6:112210570-112210592 GCACACTGACAAACACAGGAAGG - Intronic
1013912088 6:115287971-115287993 GCACACAGAAAAAGCAGAGAAGG - Intergenic
1014955087 6:127605273-127605295 ACAGACTGAAAACGAACGGATGG - Intergenic
1015095862 6:129415290-129415312 GCCCACTGAAAAAAAATCAAAGG - Intronic
1015233199 6:130940052-130940074 GCAGACTGAAAAAGGATAGGAGG + Intronic
1015872439 6:137790745-137790767 GCAATGTGAAACAGAATGGAAGG + Intergenic
1016810706 6:148258644-148258666 GCACACGTACAAAGAATGGGTGG + Intergenic
1017851862 6:158311237-158311259 GGACACTGAAAGGGAAGGGAAGG - Intronic
1017867639 6:158457766-158457788 GCACACTGAAAAAATGAGGAGGG + Intronic
1018116135 6:160587363-160587385 GCACAAGGAAAGAGGATGGAAGG - Intronic
1020155093 7:5716519-5716541 CCACACTGAATCAGAATTGAAGG - Intronic
1020982850 7:15093506-15093528 GCAGACTGAGAAAAAGTGGAGGG + Intergenic
1021554141 7:21902833-21902855 GCAAACAGATACAGAATGGATGG + Intronic
1022779228 7:33561168-33561190 ATACACTGAAGAAGAATTGATGG + Intronic
1022931040 7:35114856-35114878 GCATTCTAAAAAAGAATGAATGG - Intergenic
1023656775 7:42431025-42431047 GAGCACTTAAAAAGAATGGATGG + Intergenic
1024067567 7:45753772-45753794 GCACAATGAAAAAGAGTGTGTGG + Intergenic
1026424537 7:70277012-70277034 TCACACTGAGAACAAATGGATGG - Intronic
1027959253 7:84922564-84922586 GCAAACAGAAAAAGAATTGAAGG + Intergenic
1028141212 7:87276774-87276796 GCAGACTGAAAATAAAGGGATGG - Intergenic
1028184313 7:87764246-87764268 GAAGACTGAAAATGAATGTAAGG - Intronic
1029826935 7:103207335-103207357 GCATTCTAAAAAAGAATGAATGG - Intergenic
1030071263 7:105699780-105699802 AAACACTGAGAAAGAATGCAAGG + Intronic
1030123875 7:106136383-106136405 GTAAATTGAAAAAGAATGAATGG - Intergenic
1031075650 7:117209880-117209902 GCACACTGGAAGAGAGTGGAAGG + Exonic
1031910475 7:127511946-127511968 GAAATCTGAAAAAGAAAGGAAGG + Intergenic
1032837713 7:135689344-135689366 GAACAGTTAAAAAGAATGAAGGG + Intronic
1033292357 7:140097638-140097660 AAACCCTGAAAAAGAATGAAAGG + Exonic
1033469242 7:141629508-141629530 GAACACAGAAAAAGCATGCAAGG - Intronic
1034003189 7:147439938-147439960 GTAGACTGAAAATGAAGGGATGG - Intronic
1034029865 7:147748865-147748887 GCAGACTGAAACAAAAAGGAAGG + Intronic
1037395340 8:18435671-18435693 CCACACTGAAAAGAATTGGAAGG - Intergenic
1038782505 8:30580165-30580187 GGACACTGAGAAACAATGGCGGG + Intronic
1039217709 8:35291227-35291249 ACAAACTGAAAGAGAAGGGATGG + Intronic
1039286897 8:36051511-36051533 TCACAATGAAGAAGATTGGAAGG + Intergenic
1039640536 8:39216258-39216280 ACAGACTGAAAATAAATGGATGG - Intronic
1040042435 8:42929864-42929886 CCACACTGAAAACAACTGGAGGG - Intronic
1040868956 8:52080193-52080215 GCACAGTGCAAAAGGATTGAGGG + Intergenic
1041481390 8:58323608-58323630 GCACACTCACAATGAATGGGAGG + Intergenic
1042594331 8:70429777-70429799 GTACACTCAAAAAGAATGTAGGG + Intergenic
1043134651 8:76506265-76506287 GGAAACTGAAAAAGAATGAATGG + Intergenic
1043538033 8:81227583-81227605 CCACAGTGAACAGGAATGGAGGG - Intergenic
1044260008 8:90108039-90108061 GAAGGCAGAAAAAGAATGGAAGG - Intergenic
1044439954 8:92211355-92211377 TCATACTGAAAAAGAAAGTAAGG - Intergenic
1047714329 8:127581954-127581976 GCATCCTAAAAAAGGATGGAAGG - Intergenic
1048077154 8:131084131-131084153 ACAGACTGAAAGAGAAAGGAAGG - Intergenic
1048450825 8:134532523-134532545 ACGCACGGACAAAGAATGGAAGG + Intronic
1048593087 8:135839539-135839561 ACACACTGAAAAGGAATGTTCGG + Intergenic
1051928556 9:22358242-22358264 GCACACTGAAGAAGAACAAAAGG - Intergenic
1052566001 9:30152683-30152705 GTACACTGAAAATAAAGGGATGG - Intergenic
1052647792 9:31259616-31259638 TCCCACTGAAAAATAATGAAAGG - Intergenic
1053587369 9:39473661-39473683 GCACACTGAGAAAAAAAGGAGGG - Intergenic
1054578932 9:66891575-66891597 GCATACTGAGAAAAAAAGGAGGG + Intronic
1055400481 9:75918588-75918610 GTAAACTGAAAAAAAATGGCTGG - Intronic
1056157710 9:83855378-83855400 GCACAGAGAAATAGAATGGCTGG - Intronic
1056352834 9:85768701-85768723 GCACAGAGAAATAGAATGGCTGG + Intergenic
1056539399 9:87558392-87558414 GCAAGATGAAAAAGAATGAAGGG + Intronic
1056946328 9:91000572-91000594 GGAAGCTGAAAAATAATGGAGGG - Intergenic
1058352288 9:104039940-104039962 GTACACTGGAAAAGAAAGAAGGG + Intergenic
1058552091 9:106125561-106125583 TCAGATTGACAAAGAATGGAAGG + Intergenic
1059268517 9:113058145-113058167 GAAGACTGAAAAATAATTGATGG + Intergenic
1061651340 9:132052918-132052940 GCACACTCATAAAGAATGGAAGG - Intronic
1062700947 9:137902693-137902715 ACACACCGAAAAAGCTTGGAAGG - Intronic
1185655218 X:1679005-1679027 GCAGGCTTAGAAAGAATGGATGG + Intergenic
1186204140 X:7183664-7183686 GAAATCTCAAAAAGAATGGAAGG - Intergenic
1188175860 X:26988068-26988090 GCACACGAAAAAAGAAAGAATGG - Intergenic
1188509927 X:30924625-30924647 CCACTATGAAAAAGAAAGGAGGG + Intronic
1189096829 X:38149286-38149308 CCACACTGAACAAGTATGGCTGG + Intronic
1189829129 X:44952722-44952744 ACACACACAAAAAGGATGGAGGG - Intronic
1190796434 X:53748045-53748067 GTACACTGAAAAGGAATTGCTGG - Intergenic
1191790716 X:64969385-64969407 GCACACTCAAAAAGCAGGGTAGG + Intronic
1192400496 X:70829509-70829531 GCACACAGAAAAAGACAGAATGG + Intronic
1192903195 X:75522209-75522231 CCACAGGGAAAGAGAATGGAGGG + Intronic
1193817378 X:86120482-86120504 GCACAGTGAAAAAGAAACCAAGG - Intergenic
1194456746 X:94114074-94114096 GCACAGTGAAAAACAATAGCAGG - Intergenic
1195590361 X:106617811-106617833 AAACACTGCAAAAAAATGGATGG + Intronic
1196461145 X:115932970-115932992 GTACACTGAAAATAAAAGGATGG - Intergenic
1197289317 X:124636354-124636376 GCAGATTGAAAAATAAGGGAAGG - Intronic
1197514470 X:127408782-127408804 ACAGACTGAAAATGAAGGGATGG - Intergenic
1198190089 X:134295310-134295332 GCACACATAAAAAGACTTGATGG - Intergenic
1199515517 X:148670768-148670790 GCACACTGAAAAAGAATGGATGG - Intronic
1199759867 X:150897460-150897482 GAACACTGGAAAACAGTGGATGG - Intronic
1200900047 Y:8421689-8421711 GCACAATGAAACAGAAAGGCAGG + Intergenic
1201112025 Y:10806521-10806543 TCAGACTGCAAAGGAATGGAAGG - Intergenic
1201699655 Y:16866646-16866668 ACACTTTGAGAAAGAATGGAAGG + Intergenic
1202250727 Y:22869511-22869533 GCACAATGAAAAAGAAAGGCAGG + Intergenic
1202403716 Y:24503260-24503282 GCACAATGAAAAAGAAAGGCAGG + Intergenic
1202467063 Y:25166822-25166844 GCACAATGAAAAAGAAAGGCAGG - Intergenic