ID: 1199515958

View in Genome Browser
Species Human (GRCh38)
Location X:148675704-148675726
Sequence CAGGATGTTCATCCTGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199515951_1199515958 8 Left 1199515951 X:148675673-148675695 CCTTCCTTGTGCATCTGCTGGAT 0: 1
1: 0
2: 0
3: 19
4: 221
Right 1199515958 X:148675704-148675726 CAGGATGTTCATCCTGAGTGGGG 0: 1
1: 0
2: 0
3: 23
4: 171
1199515948_1199515958 29 Left 1199515948 X:148675652-148675674 CCTCTGGGACATCCAGAAATGCC 0: 1
1: 0
2: 2
3: 21
4: 277
Right 1199515958 X:148675704-148675726 CAGGATGTTCATCCTGAGTGGGG 0: 1
1: 0
2: 0
3: 23
4: 171
1199515949_1199515958 17 Left 1199515949 X:148675664-148675686 CCAGAAATGCCTTCCTTGTGCAT 0: 1
1: 0
2: 0
3: 19
4: 244
Right 1199515958 X:148675704-148675726 CAGGATGTTCATCCTGAGTGGGG 0: 1
1: 0
2: 0
3: 23
4: 171
1199515952_1199515958 4 Left 1199515952 X:148675677-148675699 CCTTGTGCATCTGCTGGATATGG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1199515958 X:148675704-148675726 CAGGATGTTCATCCTGAGTGGGG 0: 1
1: 0
2: 0
3: 23
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199515958 Original CRISPR CAGGATGTTCATCCTGAGTG GGG Intronic
902394897 1:16127274-16127296 CAGCATTTGCATCCTGTGTGGGG - Intronic
903212362 1:21825509-21825531 CAGGATGTCCATACTGTGTGTGG + Intronic
904347809 1:29884734-29884756 CAGGATTTTCAGCCTTGGTGAGG + Intergenic
905263057 1:36732663-36732685 ATGAATGCTCATCCTGAGTGGGG + Intergenic
907313019 1:53550627-53550649 CAGTATGGTCATCCAGTGTGGGG - Intronic
908582256 1:65528365-65528387 AAGGTTGTACATACTGAGTGTGG - Intronic
911163922 1:94708781-94708803 CGGGAAGTTCCTCCTGAGAGGGG - Intergenic
911276040 1:95860005-95860027 CTGGACGTTGATCCTGAGGGAGG - Intergenic
911696533 1:100895878-100895900 CAGGATTTTCTTCCTGAGTCCGG + Exonic
912840047 1:113031288-113031310 CAGTTTGTTCCTCCTGAGTGAGG - Intergenic
913284068 1:117211163-117211185 CAGGACTTTCCTCCTGACTGTGG + Intergenic
915234963 1:154473871-154473893 CAGGATATTCTTCCTTAATGTGG + Intronic
915306021 1:154979277-154979299 GATGATGCTCACCCTGAGTGAGG - Intergenic
915735277 1:158080688-158080710 CAGGATCTTCCTCCCGGGTGTGG + Intronic
915735477 1:158081943-158081965 CAGGATCTTCCTCCTGGGTGTGG + Intronic
919753150 1:201050818-201050840 CATTCTGGTCATCCTGAGTGTGG - Intronic
920185422 1:204156387-204156409 CTGCATGTCCTTCCTGAGTGTGG + Intronic
920529842 1:206693866-206693888 CAGGATCTCCTTCCTGAGTCAGG + Intronic
923232160 1:231997192-231997214 GAGTATGTGCACCCTGAGTGAGG - Intronic
923640344 1:235752510-235752532 CACAATCTTCATCCTTAGTGTGG - Intronic
1067378554 10:45751423-45751445 CAGGATGTGTATACTGAGGGAGG + Intronic
1067761465 10:49050982-49051004 CAGGATGTTGATCATGGGGGAGG - Intronic
1067882993 10:50062741-50062763 CAGGATGTGTATACTGAGGGAGG - Intergenic
1067886251 10:50092103-50092125 CAGGATGTGTATACTGAGGGAGG + Intronic
1069649637 10:70036090-70036112 CAGAATTTTCACCCTGGGTGGGG + Intergenic
1071534770 10:86419338-86419360 CAGGATGTTGATCATGGGGGAGG + Intergenic
1075740092 10:124690024-124690046 CTGGATTTCCATCCTGATTGTGG + Intronic
1077529784 11:3089818-3089840 CTGGATGGACACCCTGAGTGTGG + Intronic
1078158632 11:8820401-8820423 TAGGATATTCTCCCTGAGTGAGG - Intronic
1078577357 11:12513554-12513576 CAGGCTGTTCATGCTGATGGAGG - Intronic
1078976567 11:16484617-16484639 CAGGATGTCCATCCTGGGGCTGG - Intronic
1079450850 11:20598637-20598659 CAGGATGTTCAACCGTACTGTGG - Intergenic
1080472102 11:32556334-32556356 CAACATGTTAATCCTCAGTGTGG + Intergenic
1081539296 11:44018392-44018414 CAGGAGGGTAAGCCTGAGTGGGG - Intergenic
1082006181 11:47420377-47420399 CAGGATGTCCACCCTGTTTGTGG + Exonic
1082958267 11:58895048-58895070 GAGGATGTTCATCCAGGGTGTGG + Intronic
1082973810 11:59052565-59052587 GAGGATGTTCATCCAGGGTCTGG + Intergenic
1082978217 11:59096379-59096401 GAGGATGTTCATCCAGGGTCTGG + Intergenic
1083681483 11:64353830-64353852 CAGGATGTCCAGCCTGAGGGAGG - Intronic
1083714324 11:64567133-64567155 CAGGCTCTCCATCCTGAATGTGG + Intronic
1084164378 11:67368226-67368248 TAGGATGTGATTCCTGAGTGTGG + Intronic
1085166646 11:74407066-74407088 AAAGATGTGCATCCTGAGTTGGG - Intergenic
1085429360 11:76433754-76433776 CAGGATGTTGATAGTGAGGGAGG - Intergenic
1090477250 11:127034713-127034735 CAGCATGTCCATCCAGAGAGTGG - Intergenic
1090626060 11:128609947-128609969 CAGGAAGAGCATCCTGAGTGAGG + Intergenic
1091472085 12:737770-737792 CAGGATAGACATCCTGAGGGAGG - Intergenic
1095284911 12:40398626-40398648 AAGGATGTGCACTCTGAGTGAGG + Intronic
1096258724 12:50078037-50078059 AAGGAGGTTCATCCTGACTATGG - Exonic
1101102446 12:101407636-101407658 CAGGGGGTTCATCATGGGTGAGG - Exonic
1101751992 12:107589548-107589570 CAGGATGTGCAACCAGAGAGGGG + Intronic
1107488915 13:40860747-40860769 CATCATATTCATCCTGAGGGAGG + Intergenic
1107644557 13:42480208-42480230 CAAGAGATTCATCCAGAGTGTGG - Intergenic
1109274332 13:60286911-60286933 CAGGATGTTCCACATAAGTGGGG - Intergenic
1110473106 13:75882759-75882781 CAGGATGTCCAGAATGAGTGTGG + Intronic
1111807355 13:93054085-93054107 CAGGATGTTGATAGTGAGGGAGG + Intergenic
1111835912 13:93388231-93388253 AAGGATGTGCATCCTGAGTTTGG + Intronic
1116221724 14:42096197-42096219 CAGGCTGTTTATGCTGAGGGGGG + Intergenic
1120930795 14:89846273-89846295 TAGTATGTTCATCCTGAGACTGG - Intronic
1121327652 14:93030892-93030914 CACGATGTTCCTCCTTTGTGCGG - Intronic
1122569571 14:102686367-102686389 CAGGATGTTCACACTGGGGGAGG - Intronic
1129141368 15:73601159-73601181 TAGGCAGTTAATCCTGAGTGGGG + Intronic
1130923693 15:88369375-88369397 CAGGATGTTAATCAGGAGAGGGG - Intergenic
1131767083 15:95689756-95689778 CAGGATTTTGATCATTAGTGTGG + Intergenic
1131847621 15:96504514-96504536 TAGGATGTACATCCTGCGTGAGG - Intergenic
1132834770 16:1947236-1947258 CAGCGTGTTCAGCCAGAGTGAGG - Exonic
1132908910 16:2298561-2298583 CAGGATCTTCATGCTGAATGTGG - Intronic
1133277539 16:4647907-4647929 CAGGGTGCTCCTCCTGAGGGAGG - Intronic
1135753844 16:25080115-25080137 CAGGAGGTTATTCCTGAGCGTGG + Intergenic
1136640847 16:31563865-31563887 CAGGTTGTTTATACTGAGTTTGG - Intergenic
1138202369 16:55099868-55099890 GATGCTGTTCTTCCTGAGTGAGG + Intergenic
1139538984 16:67599591-67599613 CAGGAGGTTCCTCCAGACTGAGG - Intronic
1142191413 16:88719941-88719963 CAGGATGTTCAACCAGAATGTGG - Exonic
1142316567 16:89350781-89350803 CATGATGCTCATGTTGAGTGTGG + Intronic
1145936388 17:28717255-28717277 CAGAATGTTCATCCTGCCTGCGG + Exonic
1146765866 17:35520959-35520981 CAGGCTGGCCATCCTGATTGGGG - Intronic
1148495485 17:48051228-48051250 CAGGATGATCTCCCGGAGTGGGG - Exonic
1151359168 17:73578353-73578375 CAAGATGTTCAAGCTGGGTGTGG - Intronic
1151924969 17:77188539-77188561 CGAGATGTCCTTCCTGAGTGAGG - Intronic
1152086784 17:78224787-78224809 CAGGACGCTCATCCTCACTGCGG - Exonic
1153997947 18:10457691-10457713 CAAGAAGTGCATCCTGTGTGAGG + Intronic
1154930041 18:20984778-20984800 CAGAATTTTCATGCTGATTGGGG - Intronic
1155899705 18:31373770-31373792 CAGGATGTTTATCTTCAGTGTGG + Intergenic
1156526759 18:37775231-37775253 CAGGCTGTTTTTCCTGAGAGTGG + Intergenic
1157055959 18:44229211-44229233 GAGGATGTTCATACTTACTGTGG - Intergenic
1157571188 18:48713408-48713430 CAGGGTCTTCCTGCTGAGTGAGG - Intronic
1158519505 18:58159444-58159466 CAGGATGTTGATCATGGGGGAGG + Intronic
1159690579 18:71482768-71482790 CAGGAAGTTCAAACTGGGTGTGG - Intergenic
1162211233 19:9093829-9093851 TAGGATCTTCATCCTCATTGTGG + Exonic
925577825 2:5378971-5378993 CAGGATATTAAACCTGTGTGGGG - Intergenic
926086479 2:10023332-10023354 CAGGACCTCCATCCTGAGTTGGG + Intergenic
926348997 2:11978275-11978297 CAGGATGTTCTGCTTGAATGGGG - Intergenic
929767939 2:44865680-44865702 CAGGATGTTAATCCTAAATGAGG + Intergenic
931776905 2:65548766-65548788 CAGAATGTCCACCCAGAGTGGGG + Intergenic
932442562 2:71747034-71747056 CAGGATGTTCCTCCCGGCTGGGG - Intergenic
932793981 2:74679668-74679690 CAGCATGGGCATCCTGTGTGTGG + Exonic
933578718 2:84100733-84100755 CAGGATGTTGATACTGGGAGAGG + Intergenic
933650663 2:84847441-84847463 CAGGAGGGCCATCCTGAATGGGG + Intronic
936663296 2:114566205-114566227 CAGAATGTTCTTCCTGACAGTGG - Intronic
936885974 2:117310346-117310368 CAGGATGTGCAACAGGAGTGTGG + Intergenic
937011797 2:118569457-118569479 CAGCATTTTCATAATGAGTGGGG - Intergenic
937334592 2:121054242-121054264 CTGGAGGCTGATCCTGAGTGGGG + Intergenic
939663012 2:144913864-144913886 CAAGATGTTCCTCCTGATTTGGG - Intergenic
942060677 2:172225981-172226003 CAGTCTGCTCTTCCTGAGTGTGG + Intergenic
945296286 2:208174458-208174480 GAGGGTGGTCATCCCGAGTGGGG + Intronic
948541674 2:238695391-238695413 CAGCACGCTCATCCTGGGTGGGG + Intergenic
1173549483 20:43922754-43922776 CAGGATGAGCAACCTGATTGTGG + Intronic
1173940865 20:46910043-46910065 AAGGATGTTCATCTTAAGGGTGG + Intronic
1176685366 21:9844115-9844137 TAGCATGTACATCCTGGGTGTGG + Intergenic
1178969137 21:37155694-37155716 CTGGCTGTTCATCAGGAGTGGGG + Intronic
1182963627 22:34501395-34501417 CAGGATGGTCCTCCAGAGGGTGG - Intergenic
1185223338 22:49639998-49640020 CCGGATGCTCATCCTGACTCTGG - Intronic
1185319492 22:50193953-50193975 CAGCCTGTCCCTCCTGAGTGGGG + Intronic
950327957 3:12130519-12130541 AATGATGTCCATCCTCAGTGGGG + Intronic
950590892 3:13935190-13935212 CAGCAGGCTCATCCTGTGTGCGG - Intergenic
951141882 3:19171894-19171916 AAGGATCTTCATTCTGAATGAGG + Intronic
951851004 3:27139831-27139853 CTGGATGTTCTTGCTGAATGTGG - Intronic
952507844 3:34023900-34023922 CTCCATGTTCATGCTGAGTGTGG + Intergenic
952851556 3:37733930-37733952 CAGGATGTTCACACTGGGAGTGG - Intronic
954440622 3:50519876-50519898 CAGGCTGTGCTTCCTGTGTGGGG + Intergenic
957374494 3:79338403-79338425 TAAGATGATCATACTGAGTGTGG - Intronic
957426982 3:80051623-80051645 CAGGCTGTTCATGCCAAGTGGGG - Intergenic
958645486 3:96866451-96866473 CAGGATTTTCTTCCTGAATGTGG + Intronic
958889974 3:99772514-99772536 CAGGATGTTCATAATGGGGGAGG + Intronic
962641346 3:137389945-137389967 CAGGATGTTAAAACTGAATGAGG - Intergenic
964726618 3:159820159-159820181 CAGAATGTTCATCAGGAGTTTGG - Intronic
965618711 3:170621413-170621435 CAGGAAGTTCAGACTGGGTGCGG - Intronic
967632242 3:191758104-191758126 CAGGATACTCATCTTGAGAGGGG + Intergenic
968360400 3:198142965-198142987 CAAGACGTGCATCCTGAGTGAGG + Intergenic
975645163 4:76538591-76538613 CAGGATGTTCCAACTGGGTGTGG + Intronic
976149007 4:82074362-82074384 CAAGATGTTCATGCTGTGAGAGG - Intergenic
977314621 4:95430221-95430243 CAGGATGTTAATAATGAGGGAGG + Intronic
978051967 4:104212177-104212199 CAGGATGTTGATAGTGAGGGAGG - Intergenic
978561995 4:110043309-110043331 CAGGGTTTTCACCCTGGGTGGGG + Intergenic
979699121 4:123647626-123647648 CAAGGTCTTCATCCTGATTGAGG - Intergenic
980348822 4:131662586-131662608 TAGCATGTACATCCTGGGTGTGG + Intergenic
982862034 4:160464097-160464119 CAGGATTTTCAGCTTGAGGGTGG + Intergenic
984989899 4:185369918-185369940 CAGATTGTTCAGCCTGAGTGGGG - Intronic
985746373 5:1651283-1651305 CTGGGTGTTCATCCCGGGTGTGG + Intergenic
986242764 5:5976330-5976352 CAGGAGGATCATCCTGGGAGGGG - Intergenic
987490950 5:18579485-18579507 CAGGATGTTACTCTTGAGTGGGG - Intergenic
989275823 5:39586904-39586926 CTGGATGTTCAACAGGAGTGTGG - Intergenic
991945185 5:71892742-71892764 CATTATGCACATCCTGAGTGAGG - Intergenic
992198194 5:74360333-74360355 CATGGTGTTCTTCCTGTGTGTGG + Intergenic
994896449 5:105710154-105710176 CAGGATGTTGATCGTGAGGAAGG - Intergenic
1001273276 5:170331776-170331798 CAGGAGGTTCAGCCTCTGTGGGG + Intergenic
1001591517 5:172868759-172868781 CAGGATGTTGATAGTGAGGGAGG + Intronic
1002686792 5:181018487-181018509 CAGGATGTTGATGGTGAGGGAGG - Intergenic
1004237670 6:13888816-13888838 GGAGATGTTCAGCCTGAGTGAGG - Intergenic
1005279791 6:24261438-24261460 AAGCATGTTCAGCCTGAGTATGG + Intronic
1006456415 6:34134521-34134543 CTGGATTTTCATCCTGAATCAGG + Intronic
1007774033 6:44214457-44214479 CAGGATGTTTATCCGCTGTGAGG + Intergenic
1012703257 6:102490397-102490419 CAAGAAGTTAATCTTGAGTGAGG - Intergenic
1013196483 6:107848872-107848894 GAGGATGTTACTGCTGAGTGAGG - Intergenic
1014992881 6:128103580-128103602 CAGGATGTTCAACAGGGGTGTGG - Intronic
1016076740 6:139804993-139805015 CAGGCAGATCATCCTGAGTCTGG + Intergenic
1017864885 6:158434756-158434778 CAGCATTTCCATGCTGAGTGTGG + Intronic
1018718518 6:166554507-166554529 CCGGATGTGCATCCTGTGTGGGG + Intronic
1019259601 7:73668-73690 CAAGACGTGCATCCTGAGTGAGG - Intergenic
1019367786 7:644192-644214 CGGGATGTTCAACCTGCGTCAGG + Intronic
1020568152 7:9822930-9822952 CAGGATTTGCCTCCTGGGTGCGG - Intergenic
1022479878 7:30735917-30735939 CAGGATTTTGGTCCTGGGTGTGG + Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023972202 7:44999979-45000001 CAGGATCTTCAGCCTGTGGGCGG + Intronic
1026360009 7:69595126-69595148 CAGATTGTTCATTCTTAGTGTGG + Intergenic
1027124867 7:75549200-75549222 AAGGAGGTGGATCCTGAGTGAGG - Intronic
1030011848 7:105177611-105177633 GAGGATGCTCATCCTGGGGGCGG + Intronic
1031475289 7:122213724-122213746 CATGATGTTTTTCCTGGGTGAGG - Intergenic
1035469910 7:159103104-159103126 GAGGATGTTTCTCCCGAGTGTGG - Intronic
1039513473 8:38110788-38110810 TCGGATGTTCATCCTGTGTTCGG - Exonic
1039590565 8:38743173-38743195 CAAGACGTTCATCCTGAGGCTGG + Intronic
1041410941 8:57553952-57553974 CAGGATTTTCTTGCTGAGTAGGG + Intergenic
1043359998 8:79461096-79461118 CAGGATGTGCATTGTGAGGGAGG - Intergenic
1047641298 8:126824440-126824462 CAGCATGTTGTTACTGAGTGAGG + Intergenic
1048838442 8:138543815-138543837 GAGGATGTACAGCCTGAGTTTGG - Intergenic
1048838445 8:138543822-138543844 CAGGCTGTACATCCTCAGTGGGG + Intergenic
1049519576 8:143081026-143081048 CAGAAGGCTCAGCCTGAGTGGGG - Exonic
1049598193 8:143494245-143494267 CAGGAAGTTCGGCCTGAGGGTGG - Intronic
1049777812 8:144414537-144414559 CAGGAGGGTCAGCCTGAGTGAGG - Intronic
1053321044 9:37099028-37099050 CAGAGGGTTCATCCTCAGTGAGG + Intergenic
1053783942 9:41637490-41637512 TAGCATGTACATCCTGGGTGTGG - Intergenic
1054171897 9:61847631-61847653 TAGCATGTACATCCTGGGTGTGG - Intergenic
1054446758 9:65376644-65376666 TAGCATGTACATCCTGGGTGTGG - Intergenic
1054665638 9:67733181-67733203 TAGCATGTACATCCTGGGTGTGG + Intergenic
1054758422 9:68982224-68982246 CAGGATATTCCTCCTAAGAGAGG + Intronic
1055065342 9:72113058-72113080 CTGGATGTTCATGCTGTCTGGGG - Intergenic
1062745099 9:138206795-138206817 CAAGACGTGCATCCTGAGTGAGG + Intergenic
1187389373 X:18875748-18875770 CAGGAGGTTCAGCCTCAGTTGGG + Intergenic
1190442166 X:50485630-50485652 CAGGAAGTTCATTTTGATTGAGG + Intergenic
1192660557 X:73037622-73037644 CAGGTTGCACTTCCTGAGTGAGG + Intergenic
1194369216 X:93050065-93050087 CAGGATGTTGATAGTGAGGGAGG - Intergenic
1195530864 X:105956086-105956108 CAGGTTGTTCAACCTTAGTCTGG - Exonic
1196673758 X:118397731-118397753 CAGGATGTACTTAATGAGTGGGG + Intronic
1199515958 X:148675704-148675726 CAGGATGTTCATCCTGAGTGGGG + Intronic
1199626951 X:149750213-149750235 GAGGAGGATCCTCCTGAGTGAGG + Intergenic
1200677416 Y:6166302-6166324 CAGGATGTTGATAGTGAGAGAGG - Intergenic